Search result for sequence:
TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGCTTTGCAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGCAAGGCTAGAGTACGGCAGAGGGGGATGGAATTCCGCG
common ontology terms
term enrichment score
TermScore
china0.536585
water0.217054
river0.196078
fresh water0.167726
united states of america0.125000
rhizosphere0.125000
city0.097087
effluent0.096000
wastewater treatment plant0.094488
jiulong river0.093023
fujian province0.088889
hunan province0.086957
depth (soil) 50cm0.085106
spring0.074074
drinking water0.072727
costa rica0.072727
soil0.072351
rice0.071429
campinas0.071429
estuary water0.071429
bilbao0.071429
mountain0.068966
nectar0.068966
saccharum0.068966
sugarcane0.068966
oryza sativa0.067797
snow field0.066667
greenhouse0.066667
estuary0.066667
skin0.065574
flower0.064516
LOWER IN root0.064516
air0.062500
autumn0.061538
state of florida0.057971
LOWER IN winter0.057971
summer0.053333
sea water0.053097
state of california0.051282
freshwater lake0.049383
freshwater river biome0.048780
yangtze river0.048780
coreius guichenoti0.048780
largemouth bronze gudgeon0.048780
depth 6-7m0.048780
sea urchin0.048780
salinity <5 ppt0.048780
mississippi river0.048780
forearm0.048780
chuquisaca department0.048780
biomat0.048780
microbial biomat0.048780
water treatment pond0.048780
benthic biomat0.048780
engineered wetland0.048780
english channel coastal waters of france0.048780
ph 50.048193
japan0.047619
capsicum annuum0.047619
site a0.047619
site e0.047619
rice field0.047619
hong kong0.047619
lytechinus variegatus0.047619
soybean0.047619
arm0.047619
age 5-13 years0.047619
LOWER IN frog0.046512
bolivia0.046512
early timepoints0.045977
LOWER IN late timepoints0.045455
fish farm0.045455
lake0.044944
crohn's disease0.044444
brazil0.044444
jiangxi province0.044444
wet season0.044444
LOWER IN dry season0.044444
aquarium0.044444
glycine max0.043478
biofilm0.043478
kingdom of spain0.042553
bos taurus0.042105
homo sapiens0.041268
LOWER IN leaf0.040816
rural community0.040000
french republic0.038462
foodon product type0.037736
fish0.037037
farm0.035088
digestive system0.034483
saline water0.033613
LOWER IN saline water0.033613
intestine0.031250
child0.026667
bronchus0.025316
coelomic fluid0.025316
depth (soil) 0-20cm0.025316
mexico0.025316
large size0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
china5.500000
spring1.000000
bronchus1.000000
coelomic fluid1.000000
mexico1.000000
effluent0.750000
freshwater lake0.666667
wastewater treatment plant0.600000
large size0.500000
medium size0.500000
LOWER IN small size0.500000
freshwater river biome0.500000
yangtze river0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
depth 6-7m0.500000
hamelia patens0.500000
firebush0.500000
psiguria triphylla0.500000
prosciutto0.500000
children0.500000
anoplophora glabripennis0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
rice0.500000
xinxiang city prefecture0.500000
bronchial brush0.500000
hypopharynx0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
upper stem0.500000
campinas0.500000
estuary water0.500000
salinity >20 ppt0.500000
bilbao0.500000
coastal water0.500000
chitin beads0.500000
subway0.500000
eagle harbor0.500000
sea urchin0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
LOWER IN burrow0.500000
bon portage island0.500000
salinity <5 ppt0.500000
food processing factory0.500000
state of rhode island0.500000
LOWER IN no human contact0.500000
LOWER IN chernobyl exclusion zone0.500000
ukraine0.500000
bank vole0.500000
myodes glareolus0.500000
artificial seawater0.500000
jiulong river0.500000
spring water0.500000
location 50.500000
shaded0.500000
LOWER IN unshaded0.500000
LOWER IN sunlight0.500000
30-60 days0.500000
hypersaline water0.500000
depth (water) 4-9m0.500000
monimolimnion0.500000
LOWER IN depth (water) 0-3m0.500000
LOWER IN mixolimnion0.500000
romania0.500000
ursu lake0.500000
epilimnion0.500000
LOWER IN hypolimnion0.500000
dimictic lake0.500000
bog lake0.500000
ph 4.5-50.500000
"north sparkling bog" lake0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
LOWER IN salinity &gt;20 ppt0.500000
LOWER IN rana luteiventris0.500000
LOWER IN columbia spotted frog0.500000
mississippi river0.500000
LOWER IN sewage0.500000
size < 10um0.500000
clear day0.500000
elaphurus davidianus0.500000
pere deer0.500000
deer0.500000
forearm0.500000
chuquisaca department0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
ph 6-6.50.500000
biomat0.500000
microbial biomat0.500000
water treatment pond0.500000
benthic biomat0.500000
engineered wetland0.500000
arachis hypogaea0.500000
peanut0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.333333
china0.282051
water0.269231
fresh water0.141026
river0.128205
rhizosphere0.115385
homo sapiens0.102564
soil0.089744
city0.064103
drinking water0.051282
costa rica0.051282
hunan province0.051282
skin0.051282
fujian province0.051282
depth (soil) 50cm0.051282
jiulong river0.051282
wastewater treatment plant0.051282
effluent0.051282
foodon product type0.038462
spring0.038462
mountain0.038462
snow field0.038462
japan0.038462
nectar0.038462
flower0.038462
LOWER IN control0.038462
oryza sativa0.038462
rice0.038462
feces0.038462
air0.038462
brazil0.038462
greenhouse0.038462
campinas0.038462
saccharum0.038462
sugarcane0.038462
estuary0.038462
kingdom of spain0.038462
estuary water0.038462
bilbao0.038462
sea water0.038462
state of florida0.038462
autumn0.038462
summer0.038462
LOWER IN winter0.038462
LOWER IN root0.038462
state of california0.038462
capsicum annuum0.025641
freshwater river biome0.025641
intestine0.025641
yangtze river0.025641
coreius guichenoti0.025641
largemouth bronze gudgeon0.025641
fish0.025641
site a0.025641
depth 6-7m0.025641
site e0.025641
crohn's disease0.025641
digestive system0.025641
early timepoints0.025641
LOWER IN late timepoints0.025641
rice field0.025641
adult0.025641
ph 50.025641
hong kong0.025641
LOWER IN leaf0.025641
saline water0.025641
research facility0.025641
lytechinus variegatus0.025641
sea urchin0.025641
jiangxi province0.025641
LOWER IN soil0.025641
salinity <5 ppt0.025641
farm0.025641
bos taurus0.025641
lake0.025641
freshwater lake0.025641
LOWER IN frog0.025641
wet season0.025641
LOWER IN dry season0.025641
LOWER IN saline water0.025641
mississippi river0.025641
glycine max0.025641
soybean0.025641
depth (soil) 0-20cm0.025641
arm0.025641
forearm0.025641
child0.025641
bolivia0.025641
chuquisaca department0.025641
rural community0.025641
age 5-13 years0.025641
biomat0.025641
microbial biomat0.025641
water treatment pond0.025641
benthic biomat0.025641
engineered wetland0.025641
fish farm0.025641
aquarium0.025641
french republic0.025641
english channel coastal waters of france0.025641
Exp. ID User ID Description Date Region Flag Sequences
74amnondominant united states of america, capsicum annuum, foodon product type2017-02-27v4No1 / 10
115amnonhigher in medium and large size fish compared to small size ( high in large size medium size compared to small size in freshwater river biome intestine yangtze river coreius guichenoti largemouth bronze gudgeon fish china )2017-04-10v4No1 / 11
160amnonhigh freq. in river water upstream of WTP effluent in spring in china (dominant river, water, china, spring)2017-07-12v4No1 / 13
109amnondominant united states of america, water, drinking water, site a2017-04-08v4No1 / 17
287amnondominant mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 18
115amnoncommon freshwater river biome, intestine, yangtze river, coreius guichenoti, largemouth bronze gudgeon, fish, china2017-04-10v4No1 / 19
501amnoncommon nectar, costa rica, flower, hamelia patens, firebush2019-03-08v4No1 / 20
109amnondominant united states of america, water, drinking water, site e2017-04-08v4No1 / 21
501amnoncommon nectar, costa rica, flower, psiguria triphylla2019-03-08v4No1 / 21
74amnoncommon united states of america, capsicum annuum, foodon product type2017-02-27v4No1 / 23
74amnoncommon united states of america, prosciutto, foodon product type2017-02-27v4No1 / 23
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
287amnoncommon mountain, snow field, depth 1-2m, japan2018-01-29v4No1 / 35
243amnoncommon digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 38
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in digestive system costa rica butterfly )2019-03-09v4No1 / 64
373amnonlower in soil of mature plants compared to seedlings ( high in seedling early timepoints compared to late timepoints in rice field soil rhizosphere oryza sativa hunan province rice china )2018-09-08v4No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site e 2017-04-08v4No1 / 143
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
510amnoncommon estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 160
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 383
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 432
577amnon high in high salinity hypersaline water depth (water) 4-9m monimolimnion compared to low salinity depth (water) 0-3m mixolimnion depth (water) 20-100cm depth (water) 1-5m in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
373amnoncommon rice field, soil, rhizosphere, oryza sativa, hunan province, rice, china2018-09-08v4No1 / 501
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
647amnon high in lake water freshwater lake compared to skin frog rana luteiventris columbia spotted frog in united states of america state of montana 2020-09-06v4No1 / 593
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 653
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to sewage influent in city wastewater treatment plant south america )2017-01-21v4No1 / 657
271amnon high in rhizosphere glycine max soybean compared to soil in china depth (soil) 0-20cm 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
454amnon high in summer compared to winter in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 791
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
615amnon high in rhizosphere compared to endosphere root in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 913
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
615amnoncommon rhizosphere, brazil, greenhouse, campinas, saccharum, sugarcane2020-04-27v4No1 / 974
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
665amnon high in early time points compared to late time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1052
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
676amnon high in fish farm aquarium compared to water inlet in saline water sea water french republic english channel coastal waters of france 2028-02-27v4No1 / 3012
676amnon high in biofilm biofilm saline water biofilm compared to saline water sea water in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 3904
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org