Search result for sequence:
TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTGCTAAGACCGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTGGTGACTGGCAGGCTAGAGTATGGCAGAGGGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
brazil0.213283
state of michigan0.186770
rhizosphere0.184701
panama0.172757
minas gerais state0.156250
soil0.146314
sus scrofa0.145329
pig0.145329
campos rupestres0.132353
tonsil0.120401
skin0.120240
sparus aurata0.106061
seabream0.106061
open water pond0.106061
ria formosa0.106061
portuguese republic0.100719
farm0.099010
china0.096217
whole body0.096000
mexico0.093645
mosquito0.092308
body proper0.091603
fish farm0.091503
united states of america0.083835
intestine0.078358
agave0.078125
barbacenia macrantha0.078125
cultivated environment0.076142
topsoil0.075188
commonwealth of virginia0.072464
fish0.064309
junco hyemalis0.063492
songbird0.063492
guanajuato0.063492
kellogg biological station0.063492
mesic type hapludalf0.063492
kalamazoo loam0.063492
continuous corn0.063492
desert0.063291
corn0.061538
seoul0.059701
tree0.057971
third decade human stage0.057971
gill0.057971
united kingdom0.056180
pacific ocean0.054645
pond0.051948
leaf0.050000
female0.049536
cambridgeshire0.048387
vellozia epidendroides0.048387
lushan mountain0.048387
biting midge0.048387
culicoides <genus>0.048387
sand fly0.048387
gut content0.048387
ph 60.047244
newt0.047244
deer0.047244
state of california0.046512
hindgut0.046154
south korea0.045977
depth (soil) 0-10cm0.045802
forested area0.045113
homo sapiens0.044890
jiangxi province0.044118
depth (water) 500-1000m0.043165
root0.042705
adult0.041730
digestive system0.041237
LOWER IN soil0.040942
depth (soil) 0-20cm0.040000
water0.034682
isla coronado norte0.033333
dragonfish0.033333
stomiidae0.033333
captive0.033149
subtropical0.033058
tooth0.032787
myrtillocactus geometrizans0.032787
opuntia robusta0.032787
taxus0.032787
taxus mairei0.032787
brackish water0.032787
caspian sea0.032787
tomato0.032787
beach0.032787
lissotriton vulgaris0.032787
agave salmiana0.032787
age 6-10 weeks0.032787
age 8 hours0.032787
populus0.032787
culex coronator0.032787
coquillettidia0.032787
coquilettidia venezuelensis0.032787
culex declarator0.032787
skin of forehead0.032787
LOWER IN dicentrarchus labrax0.032787
LOWER IN seabass0.032787
qilian county0.032787
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state1.000000
isla coronado norte1.000000
bristlemouths1.000000
gonostomatidae <vertebrata>1.000000
dragonfish1.000000
stomiidae1.000000
raw milk1.000000
subtropical0.666667
field soil0.500000
nicotiana glauca0.500000
junco hyemalis0.500000
songbird0.500000
tooth0.500000
calophya0.500000
central park0.500000
nile tilapia0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
sediment depth 0-12cm0.500000
brackish water0.500000
caspian sea0.500000
depth (water) 150-600m0.500000
sediment depth 12-35cm0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
arachis hypogaea0.500000
peanut0.500000
food spoilage0.500000
LOWER IN fresh0.500000
beach0.500000
aerosol0.500000
san francisco bay0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
subtropical broadleaf forest biome0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
agave tequiliana0.500000
ganzi tibetan autonomous prefecture0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 1-3 weeks0.500000
age 8 hours0.500000
fungus growing ant0.500000
myrmicocrypta ednaella0.500000
LOWER IN mediterranean0.500000
yellow brown soil0.500000
populus0.500000
scinax fuscovarius0.500000
astyanax paranae0.500000
astyanax0.500000
poecilia reticulata0.500000
guppy0.500000
red pepper sauce0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
lushan mountain0.500000
elevation 200-300m0.500000
elevation 1000-1100m0.500000
elevation 1300-1400m0.500000
biting midge0.500000
culicoides foxi0.500000
culicoides <genus>0.500000
culicoides helicaniae0.500000
culicoides batesi0.500000
sand fly0.500000
lutzomyia gomezi0.500000
psychodopygus panamensis0.500000
nyssomyia trapidoi0.500000
mosquito0.500000
culex coronator0.500000
coquillettidia0.500000
coquilettidia venezuelensis0.500000
culex declarator0.500000
skin of forehead0.500000
tonsillectomy0.500000
LOWER IN dicentrarchus labrax0.500000
LOWER IN seabass0.500000
sparus aurata0.500000
seabream0.500000
open water pond0.500000
ria formosa0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.254237
soil0.169492
brazil0.161017
rhizosphere0.152542
china0.152542
state of michigan0.135593
female0.135593
farm0.127119
homo sapiens0.118644
sus scrofa0.118644
pig0.118644
panama0.110169
skin0.101695
whole body0.101695
body proper0.101695
adult0.093220
minas gerais state0.084746
tonsil0.076271
campos rupestres0.076271
mexico0.059322
intestine0.059322
sparus aurata0.059322
seabream0.059322
open water pond0.059322
ria formosa0.059322
portuguese republic0.059322
fish farm0.059322
mosquito0.050847
feces0.042373
commonwealth of virginia0.042373
LOWER IN soil0.042373
united kingdom0.042373
pacific ocean0.042373
topsoil0.042373
desert0.042373
agave0.042373
cultivated environment0.042373
fish0.042373
barbacenia macrantha0.042373
junco hyemalis0.033898
songbird0.033898
tree0.033898
depth (soil) 0-20cm0.033898
state of california0.033898
leaf0.033898
guanajuato0.033898
digestive system0.033898
pond0.033898
third decade human stage0.033898
seoul0.033898
south korea0.033898
gill0.033898
kellogg biological station0.033898
mesic type hapludalf0.033898
kalamazoo loam0.033898
continuous corn0.033898
corn0.033898
research facility0.025424
root0.025424
ph 60.025424
water0.025424
newt0.025424
cambridgeshire0.025424
depth (soil) 0-10cm0.025424
vellozia epidendroides0.025424
jiangxi province0.025424
lushan mountain0.025424
forested area0.025424
biting midge0.025424
culicoides <genus>0.025424
sand fly0.025424
captive0.025424
deer0.025424
depth (water) 500-1000m0.025424
hindgut0.025424
gut content0.025424
uropygial gland0.016949
cloaca0.016949
tooth0.016949
root canal0.016949
subgingival plaque0.016949
mouth0.016949
myrtillocactus geometrizans0.016949
opuntia robusta0.016949
cactus0.016949
semi-arid0.016949
taxus0.016949
taxus mairei0.016949
subtropical0.016949
marine sediment0.016949
brackish water0.016949
sediment0.016949
caspian sea0.016949
solanum lycopersicum0.016949
tomato0.016949
mucosa0.016949
sinusoidal space0.016949
paranasal sinus0.016949
sinusitis0.016949
duodenum0.016949
Exp. ID User ID Description Date Region Flag Sequences
56amnondominant nicotiana glauca, israel, flower, nectar2017-01-30v4No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 8
749amnondominant third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 8
975amnondominant isla coronado norte, fish, pacific ocean, gut content, hindgut, intestine, stomiidae, dragonfish, depth (water) 500-1000m2022-12-24v4No1 / 8
773amnonhigh in non iga bound bacteria compared to iga bound bacteria ( high in iga negative fraction compared to iga positive fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
749amnondominant third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 10
269amnonincreases during one month in refrigeration of yao meat ( high in late timepoint food spoilage compared to fresh early timepoint in china foodon product type )2018-01-09v4No1 / 11
89amnondominant junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 12
782amnondominant gill, sparus aurata, seabream, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v4No1 / 12
97amnoncommon calophya, adult, brazil, state of florida2017-04-01v4No1 / 13
389amnondominant pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
782amnondominant skin, sparus aurata, seabream, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v4No1 / 13
89amnondominant junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 14
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
674amnondominant culex declarator, mosquito, whole body, body proper, female, panama2020-09-28v4No1 / 15
674amnondominant mosquito, culex coronator, whole body, body proper, female, panama2020-09-28v4No1 / 17
674amnondominant mosquito, coquillettidia, coquilettidia venezuelensis, whole body, body proper, female, panama2020-09-28v4No1 / 17
95amnonhigh freq. in root canal (dominant homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 18
96amnondominant homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
674amnoncommon mosquito, coquillettidia, coquilettidia venezuelensis, whole body, body proper, female, panama2020-09-28v4No1 / 26
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 27
674amnoncommon sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v4No1 / 27
674amnoncommon nyssomyia trapidoi, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 27
975amnoncommon isla coronado norte, depth (water) 500-1000m, bristlemouths, gonostomatidae <vertebrata>, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 27
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
863amnon high in spring compared to winter in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 29
674amnoncommon mosquito, culex coronator, whole body, body proper, female, panama2020-09-28v4No1 / 31
674amnoncommon psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 34
674amnoncommon culicoides helicaniae, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 36
674amnoncommon culex declarator, mosquito, whole body, body proper, female, panama2020-09-28v4No1 / 36
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
782amnoncommon gill, sparus aurata, seabream, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v4No1 / 40
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
674amnoncommon culicoides batesi, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 48
674amnoncommon biting midge, culicoides foxi, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 49
782amnoncommon skin, sparus aurata, seabream, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v4No1 / 52
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
977amnoncommon in raw milk used for cheese production (common raw milk, milk, brazil, minas gerais state)2022-12-24v4No1 / 82
382amnoncommon water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 89
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
782amnon high in gill compared to skin in sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 132
782amnon high in sparus aurata seabream compared to seabass dicentrarchus labrax in skin open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 149
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in gill open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 174
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
863amnoncommon qilian county, farm, captive, china, forest musk deer, moschus berezovskii, deer, feces2022-01-28v4No1 / 206
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
975amnoncommon depth (water) 500-1000m, dragonfish, stomiidae, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v4No1 / 226
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
908amnoncommon guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 567
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-12v4No1 / 667
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
141amnoncommon sediment depth 0-12cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 150-600m2017-04-18v4No1 / 1549
863amnon high in qilian county moschus berezovskii forest musk deer compared to xinglong mountain national nature reserve yuzhong county moschus chrysogaster alpine musk deer in china deer captive farm feces 2022-01-28v4No1 / 1604
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
141amnoncommon sediment depth 12-35cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 200m2017-04-18v4No1 / 1659
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770

Problems / suggestions? Please email info AT dbbact DOT org