Search result for sequence:
TACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
skin0.267472
united states of america0.209382
homo sapiens0.177205
pair of nares0.138843
air0.132364
canada0.119403
nasal cavity0.104712
nasopharynx0.099502
germany0.095923
whole body0.080000
bird0.076923
poland0.076503
adult0.074303
centrocercus urophasianus0.073684
greater sage-grouse0.073684
state of wyoming0.073684
duodenum0.073012
city0.071429
mucus0.071066
farm0.068966
intestine0.068627
child0.067243
zoological garden0.066351
LOWER IN saliva0.064240
nasal wash0.063830
costa rica0.063158
LOWER IN feces0.062500
water0.061947
foot0.061856
beetle0.061856
canis lupus familiaris0.060000
larval stage0.059406
australia0.058577
leaf0.058252
research facility0.057169
arm0.054496
venezuela0.054496
amerindian0.054496
state of florida0.054299
LOWER IN mouth0.054127
hunter gatherer0.053763
african lion safari0.053763
herbivorous beetle0.053763
south florida0.053763
shark0.053763
captive0.053571
river0.053191
pig0.052356
sus scrofa0.052356
belgium0.051680
state of california0.050063
digestive system0.049020
control0.047458
atlantic ocean0.046296
ant0.043478
hong kong0.043478
nida basin0.043478
diabetes mellitus0.042553
united kingdom0.042553
felis catus0.042105
fresh water0.041026
stomach0.039216
plant0.038462
state of illinois0.033241
dust0.033241
stream0.033241
state of rhode island0.032967
small intestine0.032967
chuquisaca department0.032967
forearm0.032967
urine0.032698
state of tennessee0.032698
tree0.032698
vagina0.032432
age 5-13 years0.032432
state of michigan0.032172
south africa0.032172
french republic0.032172
bolivia0.031915
fish0.031746
brazil0.031414
italy0.031169
dog0.030928
LOWER IN caecum0.030928
horse0.030928
israel0.030691
equus caballus0.030457
pacific ocean0.029777
rural community0.029557
crematogaster0.022346
namibia0.022346
floor0.022346
LOWER IN nasopharynx0.022346
rana catesbeiana0.022346
bullfrog0.022346
LOWER IN stem0.022346
bedroom0.022222
ixodes ricinus0.022222
castor bean tick0.022222
train0.022222
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.333333
poland1.000000
state of illinois0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
crematogaster0.666667
nasal cavity0.666667
namibia0.666667
floor0.666667
dust0.666667
stream0.666667
LOWER IN nasopharynx0.666667
rana catesbeiana0.666667
bullfrog0.666667
LOWER IN stem0.666667
air0.636364
LOWER IN mouth0.571429
skin0.555556
LOWER IN saliva0.555556
pair of nares0.545455
ant0.500000
pheidole0.500000
bedroom0.500000
ixodes ricinus0.500000
castor bean tick0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
freshwater river biome0.500000
yangtze river0.500000
LOWER IN small size0.500000
large size0.500000
medium size0.500000
train0.500000
boston0.500000
hong kong0.500000
subway0.500000
hunter gatherer0.500000
ants0.500000
wound0.500000
ulcer0.500000
african lion safari0.500000
nasal wash0.500000
parkinson's disease0.500000
rem sleep behavior disorder0.500000
age <= 24 hours0.500000
camelus bactrianus0.500000
bactrian camel0.500000
anterior naris0.500000
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
perth0.500000
LOWER IN recurrent otitis media0.500000
fungus growing ant0.500000
myrmicocrypta ednaella0.500000
inguinal region0.500000
sebum0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
state of rhode island0.500000
radish0.500000
nasal cavity mucosa0.500000
cheek0.500000
tooth0.500000
interdigital region0.500000
penis0.500000
male organism0.500000
drosophila melanogaster0.500000
fruit fly0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
depth 6-7m0.500000
pseudomyrmex flavicornis0.500000
aphthona venustula0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
nicotiana galuca0.500000
fire salamander0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
acropora cervicornis0.500000
isla palominos0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
liolaemus ruibali0.500000
small intestine0.500000
age <1 year0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
centricnemus leucogrammus0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
cabbage0.500000
LOWER IN oral wash0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.346591
homo sapiens0.267045
skin0.176136
pair of nares0.079545
air0.073864
adult0.068182
canada0.062500
germany0.056818
nasopharynx0.056818
nasal cavity0.056818
research facility0.051136
whole body0.045455
city0.045455
control0.045455
farm0.045455
bird0.045455
australia0.039773
intestine0.039773
zoological garden0.039773
poland0.039773
child0.039773
mucus0.039773
centrocercus urophasianus0.039773
greater sage-grouse0.039773
state of wyoming0.039773
duodenum0.039773
water0.039773
foot0.034091
costa rica0.034091
captive0.034091
nasal wash0.034091
beetle0.034091
LOWER IN saliva0.034091
canis lupus familiaris0.034091
larval stage0.034091
LOWER IN feces0.034091
state of florida0.034091
leaf0.034091
arm0.028409
venezuela0.028409
amerindian0.028409
hunter gatherer0.028409
digestive system0.028409
african lion safari0.028409
belgium0.028409
herbivorous beetle0.028409
LOWER IN mouth0.028409
pig0.028409
sus scrofa0.028409
state of california0.028409
river0.028409
atlantic ocean0.028409
south florida0.028409
shark0.028409
diabetes mellitus0.022727
ant0.022727
stomach0.022727
hong kong0.022727
plant0.022727
nida basin0.022727
felis catus0.022727
united kingdom0.022727
fresh water0.022727
state of illinois0.017045
fish0.017045
italy0.017045
dog0.017045
urine0.017045
state of rhode island0.017045
brazil0.017045
vagina0.017045
state of michigan0.017045
south africa0.017045
feces0.017045
israel0.017045
dust0.017045
stream0.017045
LOWER IN caecum0.017045
small intestine0.017045
age 5-13 years0.017045
bolivia0.017045
rural community0.017045
chuquisaca department0.017045
forearm0.017045
french republic0.017045
equus caballus0.017045
horse0.017045
state of tennessee0.017045
pacific ocean0.017045
tree0.017045
building0.011364
bedroom0.011364
chicago0.011364
ixodes ricinus0.011364
castor bean tick0.011364
switzerland0.011364
male0.011364
urban biome0.011364
train0.011364
boston0.011364
Exp. ID User ID Description Date Region Flag Sequences
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, australia, foot)2017-11-05v4No1 / 8
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 8
408amnondominant ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 9
523amnondominant air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 10
595amnon high in male compared to female in ixodes ricinus castor bean tick whole body switzerland 2020-03-16v4No1 / 10
115amnonhigher in medium and large size fish compared to small size ( high in large size medium size compared to small size in coreius guichenoti largemouth bronze gudgeon fish freshwater river biome yangtze river intestine china )2017-04-10v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v4No1 / 11
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v4No1 / 12
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v4No1 / 14
565amnondominant skin, canada, zoological garden, captive, african lion safari, elephas maximus, asian elephant2019-11-21v3No1 / 14
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 16
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 18
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 19
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 20
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
605amnon high in control compared to recurrent otitis media in australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 27
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 45
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 66
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
596amnon high in age <1 year compared to age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 122
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
565amnoncommon skin, canada, zoological garden, captive, african lion safari, elephas maximus, asian elephant2019-11-21v3No1 / 149
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine pasture alpine compared to lowland farm lowland pasture in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 204
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 425
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834

Problems / suggestions? Please email info AT dbbact DOT org