Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCACGTCGTCTGTGAAATCCTCCAGCTTAACTGGGGGCGTGCAGGCGATACGGGCAGACTTGAGTACTACAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
southern united states0.358209
snake0.303797
skin0.265625
canada0.255319
pair of nares0.167598
ceratitis capitata0.156863
mediterranean fruit fly0.156863
bos taurus0.138728
whole body0.135593
nasal cavity0.131148
fossorial snake0.122449
agave0.122449
guanajuato0.122449
leaf surface0.115385
body proper0.112676
horse0.109091
rice0.109091
equus caballus0.103448
oryza sativa0.103448
mexico0.103448
state of california0.098765
italy0.096386
desert0.093750
farm0.089888
pantherophis obsoletus0.085106
black rat snake0.085106
arboreal snake0.085106
thamnophis sirtalis0.085106
common garter snake0.085106
carphophis amoenus0.085106
worm snake0.085106
barn0.085106
hay0.085106
chuquisaca department0.085106
forearm0.085106
larval stage0.084211
south america0.081633
age 5-13 years0.081633
arm0.081633
LOWER IN mouth0.080000
wastewater treatment plant0.078431
bolivia0.078431
LOWER IN soil0.074074
cow0.070175
rural community0.070175
LOWER IN feces0.068966
nasopharynx0.067797
sus scrofa0.065574
pig0.065574
united kingdom0.065574
leaf0.060000
city0.051948
united states of america0.050265
rhizosphere0.048387
child0.048193
annona cherimola0.044444
ficus carica0.044444
fig0.044444
prunus persica0.044444
peach0.044444
diadophis punctatus0.044444
ringneck snake0.044444
prickly pear0.044444
opuntia ficus indica0.044444
coluber constrictor0.044444
eastern racer snake0.044444
crotalus horridus0.044444
timber rattlesnake0.044444
LOWER IN sucram0.044444
standard feed0.044444
aquatic snake0.044444
nerodia sipedon0.044444
northern water snake0.044444
microbial mat0.044444
red sea0.044444
anthozoa0.044444
black band disease0.044444
low income0.044444
sewer0.044444
LOWER IN pasture0.044444
sumatran orangutan0.044444
pongo abelii0.044444
toronto zoo0.044444
agave tequiliana0.044444
agkistrodon contortrix0.044444
copperhead snake0.044444
bank vole0.044444
myodes glareolus0.044444
ukraine0.044444
LOWER IN no human contact0.044444
LOWER IN chernobyl exclusion zone0.044444
sewage0.044444
influent0.044444
LOWER IN effluent0.044444
agave salmiana0.044444
terrestrial snake0.044444
LOWER IN aquatic snake0.044444
calve0.044444
LOWER IN oral cavity0.044444
nanger granti0.044444
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
annona cherimola0.500000
ceratitis capitata0.500000
mediterranean fruit fly0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
ficus carica0.500000
fig0.500000
prunus persica0.500000
peach0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
diadophis punctatus0.500000
ringneck snake0.500000
prickly pear0.500000
opuntia ficus indica0.500000
coluber constrictor0.500000
eastern racer snake0.500000
crotalus horridus0.500000
timber rattlesnake0.500000
LOWER IN sucram0.500000
standard feed0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
microbial mat0.500000
red sea0.500000
anthozoa0.500000
black band disease0.500000
barn0.500000
hay0.500000
low income0.500000
sewer0.500000
LOWER IN pasture0.500000
sumatran orangutan0.500000
pongo abelii0.500000
toronto zoo0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
LOWER IN no human contact0.500000
LOWER IN chernobyl exclusion zone0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
agave salmiana0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
calve0.500000
LOWER IN oral cavity0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
chuquisaca department0.500000
forearm0.500000
size < 10um0.500000
dust storm0.500000
snake0.333333
state of nebraska0.333333
south america0.333333
leaf surface0.333333
human contact0.333333
brassica oleracea0.333333
seed0.333333
LOWER IN seedling0.333333
jejunum0.333333
drought environment0.333333
foot0.333333
diabetes mellitus0.333333
age 5-13 years0.333333
arm0.333333
dust0.333333
LOWER IN mouth mucosa0.333333
pair of nares0.300000
LOWER IN mouth0.285714
bos taurus0.272727
whole body0.250000
gastrointestinal system0.250000
horse0.250000
rice0.250000
wastewater treatment plant0.250000
LOWER IN left colon0.250000
juvenile organism0.250000
bolivia0.250000
nasal cavity0.222222
skin0.200000
coral0.200000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.418605
skin0.395349
snake0.279070
southern united states0.279070
canada0.139535
homo sapiens0.116279
pair of nares0.116279
larval stage0.093023
body proper0.093023
italy0.093023
whole body0.093023
ceratitis capitata0.093023
mediterranean fruit fly0.093023
bos taurus0.093023
farm0.093023
nasal cavity0.093023
state of california0.093023
fossorial snake0.069767
equus caballus0.069767
horse0.069767
rhizosphere0.069767
oryza sativa0.069767
rice0.069767
agave0.069767
desert0.069767
leaf0.069767
leaf surface0.069767
mexico0.069767
guanajuato0.069767
pantherophis obsoletus0.046512
black rat snake0.046512
arboreal snake0.046512
thamnophis sirtalis0.046512
common garter snake0.046512
carphophis amoenus0.046512
worm snake0.046512
cow0.046512
nasopharynx0.046512
control0.046512
sus scrofa0.046512
pig0.046512
united kingdom0.046512
barn0.046512
hay0.046512
LOWER IN soil0.046512
south america0.046512
city0.046512
wastewater treatment plant0.046512
LOWER IN feces0.046512
soil0.046512
LOWER IN control0.046512
LOWER IN mouth0.046512
child0.046512
age 5-13 years0.046512
bolivia0.046512
rural community0.046512
chuquisaca department0.046512
arm0.046512
forearm0.046512
annona cherimola0.023256
ficus carica0.023256
fig0.023256
prunus persica0.023256
peach0.023256
diadophis punctatus0.023256
ringneck snake0.023256
prickly pear0.023256
opuntia ficus indica0.023256
LOWER IN antibiotic0.023256
dentition0.023256
subgingival plaque0.023256
state of nebraska0.023256
mouth0.023256
coluber constrictor0.023256
eastern racer snake0.023256
crotalus horridus0.023256
timber rattlesnake0.023256
diet0.023256
LOWER IN sucram0.023256
gastrointestinal system0.023256
standard feed0.023256
aquatic snake0.023256
nerodia sipedon0.023256
northern water snake0.023256
ocean0.023256
microbial mat0.023256
red sea0.023256
coral0.023256
anthozoa0.023256
black band disease0.023256
disease0.023256
low income0.023256
sewer0.023256
LOWER IN pasture0.023256
sumatran orangutan0.023256
pongo abelii0.023256
toronto zoo0.023256
captive0.023256
zoological garden0.023256
agave tequiliana0.023256
Exp. ID User ID Description Date Region Flag Sequences
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
536amnonhighfreq snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, italy, whole body, peach, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
536amnonhighfreq snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
536amnonhighfreq snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 20
536amnonhighfreq snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 50
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 119
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
384amnon high in barn hay compared to pasture in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 161
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org