Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCACGTCGTCTGTGAAATCCTCCAGCTTAACTGGGGGCGTGCAGGCGATACGGGCAGACTTGAGTACTACAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
southern united states0.342857
snake0.292683
skin0.246734
canada0.230769
pair of nares0.155440
ceratitis capitata0.148148
mediterranean fruit fly0.148148
bos taurus0.129032
nasal cavity0.125000
fossorial snake0.115385
ryegrass0.115385
days 30-400.115385
agave0.115385
guanajuato0.115385
whole body0.114286
10 cm depth0.109091
rice0.103448
leaf surface0.103448
body proper0.102564
oryza sativa0.098361
mexico0.098361
state of california0.095238
jiangsu province0.093750
horse0.093750
ph 7-80.089552
equus caballus0.089552
desert0.089552
italy0.088889
rhizosphere0.082759
larval stage0.081633
pantherophis obsoletus0.080000
black rat snake0.080000
arboreal snake0.080000
thamnophis sirtalis0.080000
common garter snake0.080000
carphophis amoenus0.080000
worm snake0.080000
barn0.080000
hay0.080000
chuquisaca department0.080000
forearm0.080000
farm0.078431
south america0.076923
age 5-13 years0.076923
arm0.076923
LOWER IN mouth0.075472
wastewater treatment plant0.074074
bolivia0.074074
LOWER IN soil0.068966
cow0.064516
LOWER IN feces0.064516
sus scrofa0.062500
pig0.062500
united kingdom0.062500
rural community0.062500
nasopharynx0.060606
leaf0.056604
soil0.049140
city0.048780
united states of america0.046997
child0.043478
annona cherimola0.041667
ficus carica0.041667
fig0.041667
prunus persica0.041667
peach0.041667
diadophis punctatus0.041667
ringneck snake0.041667
prickly pear0.041667
opuntia ficus indica0.041667
without biochar0.041667
coluber constrictor0.041667
eastern racer snake0.041667
crotalus horridus0.041667
timber rattlesnake0.041667
LOWER IN sucram0.041667
standard feed0.041667
aquatic snake0.041667
nerodia sipedon0.041667
northern water snake0.041667
microbial mat0.041667
red sea0.041667
anthozoa0.041667
black band disease0.041667
low income0.041667
sewer0.041667
LOWER IN pasture0.041667
toronto zoo0.041667
agave tequiliana0.041667
agkistrodon contortrix0.041667
copperhead snake0.041667
bank vole0.041667
myodes glareolus0.041667
ukraine0.041667
LOWER IN no human contact0.041667
LOWER IN chernobyl exclusion zone0.041667
sewage0.041667
influent0.041667
LOWER IN effluent0.041667
agave salmiana0.041667
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
annona cherimola0.500000
ceratitis capitata0.500000
mediterranean fruit fly0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
ficus carica0.500000
fig0.500000
prunus persica0.500000
peach0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
carphophis amoenus0.500000
worm snake0.500000
fossorial snake0.500000
diadophis punctatus0.500000
ringneck snake0.500000
prickly pear0.500000
opuntia ficus indica0.500000
without biochar0.500000
ryegrass0.500000
days 30-400.500000
coluber constrictor0.500000
eastern racer snake0.500000
crotalus horridus0.500000
timber rattlesnake0.500000
LOWER IN sucram0.500000
standard feed0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
microbial mat0.500000
red sea0.500000
anthozoa0.500000
black band disease0.500000
barn0.500000
hay0.500000
low income0.500000
sewer0.500000
LOWER IN pasture0.500000
toronto zoo0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
LOWER IN no human contact0.500000
LOWER IN chernobyl exclusion zone0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
agave salmiana0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
calve0.500000
LOWER IN oral cavity0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
chuquisaca department0.500000
forearm0.500000
size < 10um0.500000
dust storm0.500000
snake0.333333
10 cm depth0.333333
state of nebraska0.333333
south america0.333333
pongo abelii0.333333
sumatran orangutan0.333333
human contact0.333333
brassica oleracea0.333333
seed0.333333
LOWER IN seedling0.333333
jejunum0.333333
drought environment0.333333
LOWER IN male0.333333
foot0.333333
diabetes mellitus0.333333
age 5-13 years0.333333
arm0.333333
dust0.333333
LOWER IN mouth mucosa0.333333
LOWER IN mouth0.285714
pair of nares0.272727
bos taurus0.250000
rice0.250000
wastewater treatment plant0.250000
leaf surface0.250000
LOWER IN left colon0.250000
juvenile organism0.250000
bolivia0.250000
nasal cavity0.222222
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.391304
skin0.369565
snake0.260870
southern united states0.260870
rhizosphere0.130435
canada0.130435
soil0.108696
homo sapiens0.108696
pair of nares0.108696
larval stage0.086957
body proper0.086957
italy0.086957
whole body0.086957
ceratitis capitata0.086957
mediterranean fruit fly0.086957
bos taurus0.086957
farm0.086957
nasal cavity0.086957
state of california0.086957
fossorial snake0.065217
china0.065217
jiangsu province0.065217
10 cm depth0.065217
ph 7-80.065217
ryegrass0.065217
days 30-400.065217
equus caballus0.065217
horse0.065217
oryza sativa0.065217
rice0.065217
agave0.065217
desert0.065217
leaf0.065217
leaf surface0.065217
mexico0.065217
guanajuato0.065217
pantherophis obsoletus0.043478
black rat snake0.043478
arboreal snake0.043478
thamnophis sirtalis0.043478
common garter snake0.043478
carphophis amoenus0.043478
worm snake0.043478
cow0.043478
nasopharynx0.043478
control0.043478
sus scrofa0.043478
pig0.043478
united kingdom0.043478
barn0.043478
hay0.043478
LOWER IN soil0.043478
south america0.043478
city0.043478
wastewater treatment plant0.043478
LOWER IN feces0.043478
LOWER IN control0.043478
LOWER IN mouth0.043478
child0.043478
age 5-13 years0.043478
bolivia0.043478
rural community0.043478
chuquisaca department0.043478
arm0.043478
forearm0.043478
annona cherimola0.021739
ficus carica0.021739
fig0.021739
prunus persica0.021739
peach0.021739
diadophis punctatus0.021739
ringneck snake0.021739
prickly pear0.021739
opuntia ficus indica0.021739
LOWER IN biochar0.021739
without biochar0.021739
LOWER IN antibiotic0.021739
dentition0.021739
subgingival plaque0.021739
state of nebraska0.021739
mouth0.021739
coluber constrictor0.021739
eastern racer snake0.021739
crotalus horridus0.021739
timber rattlesnake0.021739
diet0.021739
LOWER IN sucram0.021739
gastrointestinal system0.021739
standard feed0.021739
aquatic snake0.021739
nerodia sipedon0.021739
northern water snake0.021739
ocean0.021739
microbial mat0.021739
red sea0.021739
coral0.021739
anthozoa0.021739
black band disease0.021739
disease0.021739
low income0.021739
Exp. ID User ID Description Date Region Flag Sequences
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
536amnondominant snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, italy, whole body, peach, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
536amnondominant snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
536amnondominant snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 20
536amnondominant snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 30
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 50
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 119
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
384amnon high in barn hay compared to pasture in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 161
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017

Problems / suggestions? Please email info AT dbbact DOT org