Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTCAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
urocyon littoralis catalinae0.363636
santa catalina island fox0.363636
santa catalina island0.363636
urocyon littoralis0.363636
penis0.363636
skin of body0.363636
umbilicus0.363636
male organism0.307692
ear canal0.266667
external acoustic meatus0.266667
south florida0.222222
shark0.222222
LOWER IN perianal skin0.222222
commonwealth of pennsylvania0.210526
south africa0.190476
male0.160000
LOWER IN rectum0.142857
atlantic ocean0.133333
skin0.123077
state of florida0.090909
wild0.088889
dentition0.076923
adult0.034632
united states of america0.027881
homo sapiens0.019753
Fraction of dbbact annotations with this term covered by the query
TermScore
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
penis0.500000
skin of body0.500000
umbilicus0.500000
south florida0.500000
shark0.500000
LOWER IN perianal skin0.500000
male organism0.333333
ear canal0.250000
external acoustic meatus0.250000
commonwealth of pennsylvania0.166667
south africa0.142857
LOWER IN rectum0.142857
atlantic ocean0.125000
male0.111111
skin0.068966
state of florida0.066667
wild0.052632
dentition0.052632
adult0.017857
united states of america0.014218
homo sapiens0.010050
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.714286
skin0.571429
adult0.571429
homo sapiens0.571429
urocyon littoralis catalinae0.285714
santa catalina island fox0.285714
santa catalina island0.285714
wild0.285714
urocyon littoralis0.285714
ear canal0.285714
external acoustic meatus0.285714
penis0.285714
south africa0.285714
male organism0.285714
male0.285714
skin of body0.285714
umbilicus0.285714
commonwealth of pennsylvania0.285714
atlantic ocean0.142857
south florida0.142857
state of florida0.142857
shark0.142857
dentition0.142857
LOWER IN perianal skin0.142857
LOWER IN rectum0.142857

Problems / suggestions? Please email info AT dbbact DOT org