Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
oncorhynchus mykiss0.160000
rainbow trout0.160000
sweden0.151203
united states of america0.135127
bos taurus0.129930
skin0.129380
pig0.126506
sus scrofa0.126506
air0.126506
digestive system0.121827
farm0.111888
homo sapiens0.099851
city0.093023
canada0.089888
fish0.088889
dust0.087912
pre pupae insect diet0.086022
fresh water0.085714
research facility0.083333
LOWER IN feces0.077670
female0.076336
adult0.075117
river0.073394
rumen0.072072
state of michigan0.070796
poland0.068182
pyrenees0.065934
LOWER IN fishmeal diet0.065934
holstein-friesian bull0.065934
chuquisaca department0.065934
forearm0.065934
size < 10um0.065934
agave0.065934
guanajuato0.065934
jiulong river0.065934
fujian province0.065934
leaf0.064000
tonsil0.063830
vagina0.063830
pregnancy0.063830
age 5-13 years0.063830
arm0.063830
depth 0.5m0.063830
rectum0.063158
feces0.062926
kingdom of denmark0.062827
pair of nares0.061856
ireland0.061856
bolivia0.061856
leaf surface0.061856
cow0.060914
child0.059259
mexico0.058252
canis lupus familiaris0.057692
water0.057692
larval stage0.056604
state of california0.056604
desert0.056604
rural community0.052174
age0.051502
kingdom of spain0.048387
israel0.047244
urocyon littoralis catalinae0.044944
santa catalina island fox0.044944
santa catalina island0.044944
urocyon littoralis0.044944
ixodes scapularis0.044944
liolaemus ruibali0.044944
LOWER IN larvae insect diet0.044944
defatted larvae insect diet0.044944
larvae insect diet0.044944
jinhua city prefecture0.044944
jinhua pig0.044944
herbivorous beetle0.044944
clear day0.044944
days 30-400.044944
ryegrass0.044944
tick0.043956
argentina0.043956
south america0.043956
beetle0.043956
10 cm depth0.043956
LOWER IN control0.043668
hospital0.043478
horse0.043478
LOWER IN mouth0.043478
ear canal0.043011
external acoustic meatus0.043011
small intestine0.043011
equus caballus0.043011
wastewater treatment plant0.042105
autumn0.042105
nasal cavity0.042105
LOWER IN dry season0.041237
wet season0.041237
jiangsu province0.041237
china0.040423
south africa0.040404
whole body0.040404
ph 7-80.040404
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
poland1.000000
dust0.666667
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
ants0.500000
calophya0.500000
pre pupae insect diet0.500000
parkinson's disease0.500000
age 8 hours0.500000
ixodes scapularis0.500000
pyrenees0.500000
spring0.500000
liolaemus ruibali0.500000
pixr immunized0.500000
LOWER IN larvae insect diet0.500000
defatted larvae insect diet0.500000
larvae insect diet0.500000
LOWER IN fishmeal diet0.500000
defatted larvae insects diet0.500000
LOWER IN colon0.500000
holstein-friesian bull0.500000
605 days0.500000
LOWER IN 660 days0.500000
LOWER IN bacterial vaginosis0.500000
south florida0.500000
shark0.500000
train0.500000
boston0.500000
ulcerative colitis0.500000
chuquisaca department0.500000
forearm0.500000
pre-pupae insect diet0.500000
LOWER IN age one month0.500000
LOWER IN defatted larvae insect diet0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 20.500000
LOWER IN farm 10.500000
low income0.500000
sewer0.500000
age one month0.500000
LOWER IN age one year0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
bangladesh0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
lapland0.500000
theropithecus gelada0.500000
jiulong river0.500000
fujian province0.500000
house mice0.500000
queens region0.500000
LOWER IN manhatten region0.500000
LOWER IN stagnant water0.500000
LOWER IN perianal skin0.500000
sewage0.500000
LOWER IN effluent0.500000
pycnoscelus surinamensis0.500000
cockroach0.500000
burrowing cockroach0.500000
agave salmiana0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
calve0.500000
LOWER IN oral cavity0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
dust storm0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
days 30-400.500000
ryegrass0.500000
restricted feed0.500000
LOWER IN normal feed0.500000
depth 1m0.500000
LOWER IN filtered 0.2um0.500000
peru0.333333
crematogaster0.333333
age 50-80 years0.333333
tonsil0.333333
tanzania0.333333
dense settlement biome0.333333
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.270588
homo sapiens0.211765
research facility0.200000
digestive system0.141176
feces0.141176
sweden0.129412
fish0.117647
oncorhynchus mykiss0.117647
rainbow trout0.117647
adult0.094118
farm0.094118
skin0.094118
pig0.082353
sus scrofa0.082353
air0.082353
bos taurus0.082353
china0.082353
LOWER IN control0.058824
female0.058824
city0.058824
water0.058824
fresh water0.058824
pre pupae insect diet0.047059
state of michigan0.047059
canada0.047059
control0.047059
dust0.047059
LOWER IN feces0.047059
rumen0.047059
child0.047059
leaf0.047059
river0.047059
tonsil0.035294
vagina0.035294
pregnancy0.035294
larval stage0.035294
canis lupus familiaris0.035294
pair of nares0.035294
kingdom of spain0.035294
pyrenees0.035294
cow0.035294
LOWER IN fishmeal diet0.035294
state of california0.035294
holstein-friesian bull0.035294
ireland0.035294
age0.035294
rectum0.035294
age 5-13 years0.035294
bolivia0.035294
rural community0.035294
chuquisaca department0.035294
arm0.035294
forearm0.035294
kingdom of denmark0.035294
poland0.035294
israel0.035294
size < 10um0.035294
agave0.035294
desert0.035294
leaf surface0.035294
mexico0.035294
guanajuato0.035294
depth 0.5m0.035294
jiulong river0.035294
fujian province0.035294
urocyon littoralis catalinae0.023529
santa catalina island fox0.023529
santa catalina island0.023529
wild0.023529
urocyon littoralis0.023529
ear canal0.023529
external acoustic meatus0.023529
state of florida0.023529
hospital0.023529
tick0.023529
ixodes scapularis0.023529
body proper0.023529
liolaemus ruibali0.023529
small intestine0.023529
argentina0.023529
winter0.023529
nasopharynx0.023529
LOWER IN larvae insect diet0.023529
defatted larvae insect diet0.023529
larvae insect diet0.023529
south africa0.023529
horse0.023529
equus caballus0.023529
infant0.023529
jinhua city prefecture0.023529
jinhua pig0.023529
south america0.023529
wastewater treatment plant0.023529
whole body0.023529
beetle0.023529
herbivorous beetle0.023529
clear day0.023529
autumn0.023529
summer0.023529
LOWER IN winter0.023529
Exp. ID User ID Description Date Region Flag Sequences
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 5
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v4No1 / 11
97amnoncommon calophya, adult, brazil, state of florida2017-04-01v4No1 / 12
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, pre pupae insect diet2018-11-05v4No1 / 14
591amnon high in parkinson's disease compared to control in homo sapiens feces adult age 50-80 years united states of america 2020-02-17v4No1 / 19
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 21
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 24
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 30
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 30
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 31
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 31
71amnoncommon liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 32
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 34
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 40
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 41
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 44
392amnon high in defatted larvae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 45
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 49
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 50
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 54
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 54
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 56
392amnon high in defatted larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 57
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 66
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 71
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in 605 days age compared to 660 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 79
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 83
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 102
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 106
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 106
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 115
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 117
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 120
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 120
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 124
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 125
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 126
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 133
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 135
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 138
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 147
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 152
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 154
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 156
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 157
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 161
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 172
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 175
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 194
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 200
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 204
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 209
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 212
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 226
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 231
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 261
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 265
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 327
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 346
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 361
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 364
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 373
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 439
283amnoncommon pycnoscelus surinamensis, cockroach, burrowing cockroach, research facility, kingdom of denmark, hindgut, digestive system2018-01-25v4No1 / 447
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 451
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 456
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 491
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 517
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 570
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 580
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 644
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 756
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 764
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 790
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 835
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 901
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 949
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 965
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1013
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1016
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1734
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2265

Problems / suggestions? Please email info AT dbbact DOT org