Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
perianal skin0.375000
penis0.285714
age 20-30 years0.285714
male organism0.250000
dermal layer of tongue0.250000
canada0.250000
toronto0.250000
ear canal0.222222
external acoustic meatus0.222222
tongue0.181818
wild0.179104
LOWER IN lip0.166667
LOWER IN labial commissure0.166667
LOWER IN ear canal0.166667
LOWER IN external acoustic meatus0.166667
south africa0.166667
ursus arctos0.153846
brown bear0.153846
LOWER IN supragingival dental plaque0.153846
rectum0.150000
male0.142857
LOWER IN supragingival plaque0.133333
LOWER IN dentition0.117647
LOWER IN saliva0.095238
sweden0.095238
LOWER IN winter0.080000
summer0.068966
skin0.058824
adult0.034188
homo sapiens0.019608
united states of america0.009390
feces0.007782
Fraction of dbbact annotations with this term covered by the query
TermScore
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
penis0.500000
perianal skin0.500000
age 20-30 years0.500000
LOWER IN lip0.500000
LOWER IN labial commissure0.500000
LOWER IN ear canal0.500000
LOWER IN external acoustic meatus0.500000
male organism0.333333
dermal layer of tongue0.333333
canada0.333333
toronto0.333333
ursus arctos0.333333
brown bear0.333333
LOWER IN supragingival dental plaque0.333333
ear canal0.250000
external acoustic meatus0.250000
LOWER IN supragingival plaque0.200000
tongue0.166667
south africa0.142857
LOWER IN dentition0.142857
male0.111111
wild0.105263
rectum0.100000
LOWER IN saliva0.090909
sweden0.090909
LOWER IN winter0.066667
summer0.052632
skin0.034483
adult0.017857
homo sapiens0.010050
united states of america0.004739
feces0.004049
Fraction of annotations for the query sequences containing the term
TermScore
wild0.600000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
united states of america0.500000
urocyon littoralis0.500000
adult0.400000
homo sapiens0.400000
perianal skin0.300000
rectum0.300000
ear canal0.200000
external acoustic meatus0.200000
penis0.200000
skin0.200000
south africa0.200000
male organism0.200000
male0.200000
tongue0.200000
dermal layer of tongue0.200000
canada0.200000
toronto0.200000
age 20-30 years0.200000
LOWER IN saliva0.100000
LOWER IN lip0.100000
LOWER IN labial commissure0.100000
ursus arctos0.100000
brown bear0.100000
feces0.100000
sweden0.100000
summer0.100000
LOWER IN winter0.100000
LOWER IN dentition0.100000
LOWER IN supragingival plaque0.100000
LOWER IN supragingival dental plaque0.100000
LOWER IN ear canal0.100000
LOWER IN external acoustic meatus0.100000
Exp. ID User ID Description Date Region Flag Sequences
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 5
606amnondominant penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 16
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 18
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 43
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 71
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 87
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 104
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 109
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 305
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 399

Problems / suggestions? Please email info AT dbbact DOT org