Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGCCCGCAGCTTAACTGCGGGACTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
skin0.245487
air0.189383
pair of nares0.165289
united states of america0.158920
homo sapiens0.150818
city0.098765
dust0.096618
nasal cavity0.090090
poland0.090090
beetle0.090090
belgium0.088106
whole body0.086207
mucus0.079365
building0.078431
state of illinois0.078431
arm0.078431
urban biome0.076923
herbivorous beetle0.076923
LOWER IN mouth0.075949
duodenum0.074074
new york city0.071429
plant0.071429
fresh water0.066667
state of florida0.065574
water0.064620
australia0.063492
state of california0.059701
amerindian0.059701
venezuela0.059701
floor0.059701
hunter gatherer0.058824
nida basin0.058824
child0.058824
chuquisaca department0.058824
forearm0.058824
size < 10um0.058824
axilla0.057143
depth 0-5cm0.057143
foot0.057143
age 5-13 years0.057143
finland0.056338
felis catus0.056338
bird0.056338
inguinal region0.055556
nasopharynx0.055556
snow0.055556
river0.055556
atlantic ocean0.055556
bolivia0.055556
sweden0.054795
LOWER IN saliva0.054795
LOWER IN feces0.054054
rural community0.051282
canis lupus familiaris0.050000
israel0.047619
adult0.045455
LOWER IN nasopharynx0.040404
bedroom0.040000
chicago0.040000
sebum0.040000
train0.040000
boston0.040000
contact lens0.040000
anterior naris0.040000
lapland0.040000
centrocercus urophasianus0.040000
greater sage-grouse0.040000
state of wyoming0.040000
tap water0.040000
depth 10 cm0.040000
north america0.040000
respiratory airway0.040000
exhaled air condensate0.040000
whale blow0.040000
bathroom0.040000
shower0.040000
tile0.040000
building wall0.040000
yellowstone national park0.040000
south florida0.040000
shark0.040000
hong kong0.040000
clear day0.040000
decaying0.040000
sea urchin0.040000
beach0.040000
aerosol0.040000
coral0.039604
kingdom of the netherlands0.039216
diabetes mellitus0.039216
megaptera novaeangliae0.039216
humpback whale0.039216
geothermal field0.039216
cactus0.039216
lytechinus variegatus0.039216
jejunum0.039216
LOWER IN sea water0.038835
high temperature environment0.038462
LOWER IN caecum0.037736
mexico0.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
building0.666667
state of illinois0.666667
amerindian0.666667
venezuela0.666667
floor0.666667
dust0.666667
LOWER IN nasopharynx0.666667
arm0.666667
air0.545455
bedroom0.500000
chicago0.500000
sebum0.500000
urban biome0.500000
train0.500000
boston0.500000
hunter gatherer0.500000
contact lens0.500000
acropora hyacinthus0.500000
tissue0.500000
age <= 24 hours0.500000
anterior naris0.500000
skin of face0.500000
skin under eyes0.500000
lapland0.500000
LOWER IN state of colorado0.500000
cleanroom0.500000
aphthona venustula0.500000
nida basin0.500000
herbivorous beetle0.500000
gut content0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
cold environment0.500000
acropora cervicornis0.500000
isla palominos0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
tap water0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
centricnemus leucogrammus0.500000
age <=24 hours0.500000
LOWER IN age >= 7 days0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN pacific ocean0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
yellowstone national park0.500000
LOWER IN bacterial vaginosis0.500000
south florida0.500000
shark0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
thermophilic sediment0.500000
delphinus delphis0.500000
LOWER IN sinusitis0.500000
LOWER IN chronic rhinosinusitis0.500000
chuquisaca department0.500000
forearm0.500000
hong kong0.500000
crioceris duodecimpunctata0.500000
subway0.500000
bangladesh0.500000
siganidae0.500000
rabbitfish0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
southern united states0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
sea urchin0.500000
eagle harbor0.500000
beach0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.364583
homo sapiens0.354167
skin0.177083
air0.114583
pair of nares0.104167
city0.062500
adult0.062500
nasal cavity0.052083
belgium0.052083
dust0.052083
mucus0.052083
poland0.052083
whole body0.052083
beetle0.052083
water0.052083
building0.041667
state of illinois0.041667
urban biome0.041667
new york city0.041667
state of california0.041667
LOWER IN mouth0.041667
australia0.041667
plant0.041667
herbivorous beetle0.041667
duodenum0.041667
fresh water0.041667
state of florida0.041667
child0.041667
arm0.041667
inguinal region0.031250
axilla0.031250
amerindian0.031250
hunter gatherer0.031250
venezuela0.031250
finland0.031250
nasopharynx0.031250
snow0.031250
depth 0-5cm0.031250
sweden0.031250
floor0.031250
felis catus0.031250
LOWER IN saliva0.031250
canis lupus familiaris0.031250
foot0.031250
nida basin0.031250
research facility0.031250
bird0.031250
river0.031250
atlantic ocean0.031250
control0.031250
LOWER IN feces0.031250
age 5-13 years0.031250
bolivia0.031250
rural community0.031250
chuquisaca department0.031250
forearm0.031250
israel0.031250
size < 10um0.031250
bedroom0.020833
chicago0.020833
sebum0.020833
train0.020833
boston0.020833
contact lens0.020833
coral0.020833
age0.020833
infant0.020833
kingdom of the netherlands0.020833
anterior naris0.020833
lapland0.020833
kingdom of norway0.020833
diabetes mellitus0.020833
digestive system0.020833
centrocercus urophasianus0.020833
greater sage-grouse0.020833
state of wyoming0.020833
LOWER IN caecum0.020833
drinking water0.020833
tap water0.020833
depth 10 cm0.020833
north america0.020833
megaptera novaeangliae0.020833
humpback whale0.020833
respiratory airway0.020833
exhaled air condensate0.020833
whale blow0.020833
LOWER IN nasopharynx0.020833
bathroom0.020833
shower0.020833
tile0.020833
building wall0.020833
yellowstone national park0.020833
geothermal field0.020833
high temperature environment0.020833
south africa0.020833
vagina0.020833
south florida0.020833
shark0.020833
LOWER IN sea water0.020833
hong kong0.020833
Exp. ID User ID Description Date Region Flag Sequences
26amnon high in inguinal region axilla compared to pair of nares mucus in united states of america homo sapiens 2016-12-05v4No1 / 6
523amnonhighfreq air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 10
26amnonhigh freq. in combined swab of inguinal region and axilla (highfreq homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 11
195amnonhigh freq. in boston subway surfaces (highfreq city, urban biome, train, boston)2017-09-07v4No1 / 11
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
58amnonhighfreq homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
418amnonhighfreq coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
567amnoncommon pair of nares, anterior naris, homo sapiens, adult, belgium2019-12-05v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 21
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 66
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
567amnon high in control compared to sinusitis chronic rhinosinusitis in nasopharynx belgium adult homo sapiens 2019-12-05v4No1 / 114
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229

Problems / suggestions? Please email info AT dbbact DOT org