Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGCCCGCAGCTTAACTGCGGGACTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
skin0.275862
air0.183079
united states of america0.157447
pair of nares0.156863
homo sapiens0.156761
whole body0.101695
city0.094488
dust0.093023
poland0.090909
nasal cavity0.086957
beetle0.086957
belgium0.085106
australia0.077922
mucus0.076923
building0.075472
state of illinois0.075472
arm0.075472
urban biome0.074074
herbivorous beetle0.074074
LOWER IN mouth0.073171
duodenum0.071429
new york city0.068966
plant0.068966
adult0.065123
fresh water0.063830
water0.061538
state of florida0.061538
state of california0.057971
amerindian0.057416
venezuela0.057416
floor0.057416
hunter gatherer0.056604
nida basin0.056604
chuquisaca department0.056604
forearm0.056604
size < 10um0.056604
foot0.055046
age 5-13 years0.055046
child0.054795
finland0.054299
felis catus0.054299
south africa0.054299
inguinal region0.053571
axilla0.053571
snow0.053571
depth 0-5cm0.053571
bird0.053571
river0.053571
atlantic ocean0.053571
bolivia0.053571
LOWER IN saliva0.052863
nasopharynx0.052174
sweden0.052174
LOWER IN feces0.051724
canis lupus familiaris0.048387
rural community0.047244
israel0.043165
LOWER IN nasopharynx0.038835
bedroom0.038462
sebum0.038462
train0.038462
boston0.038462
contact lens0.038462
skin of body0.038462
umbilicus0.038462
lapland0.038462
anterior naris0.038462
centrocercus urophasianus0.038462
greater sage-grouse0.038462
state of wyoming0.038462
tap water0.038462
depth 10 cm0.038462
north america0.038462
respiratory airway0.038462
exhaled air condensate0.038462
whale blow0.038462
bathroom0.038462
shower0.038462
tile0.038462
building wall0.038462
yellowstone national park0.038462
south florida0.038462
shark0.038462
hong kong0.038462
clear day0.038462
decaying0.038462
sea urchin0.038462
beach0.038462
aerosol0.038462
coral0.038095
chicago0.037736
diabetes mellitus0.037736
megaptera novaeangliae0.037736
humpback whale0.037736
geothermal field0.037736
cactus0.037736
lytechinus variegatus0.037736
jejunum0.037736
LOWER IN sea water0.037383
kingdom of the netherlands0.037037
Fraction of dbbact annotations with this term covered by the query
TermScore
building0.666667
state of illinois0.666667
amerindian0.666667
venezuela0.666667
floor0.666667
dust0.666667
LOWER IN nasopharynx0.666667
arm0.666667
air0.545455
bedroom0.500000
sebum0.500000
urban biome0.500000
train0.500000
boston0.500000
hunter gatherer0.500000
contact lens0.500000
acropora hyacinthus0.500000
tissue0.500000
skin of body0.500000
umbilicus0.500000
age <= 24 hours0.500000
skin of face0.500000
skin under eyes0.500000
lapland0.500000
LOWER IN state of colorado0.500000
anterior naris0.500000
cleanroom0.500000
ixodes fecialis0.500000
penis0.500000
male organism0.500000
poland0.500000
aphthona venustula0.500000
nida basin0.500000
herbivorous beetle0.500000
gut content0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
cold environment0.500000
acropora cervicornis0.500000
isla palominos0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
tap water0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
centricnemus leucogrammus0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN pacific ocean0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
yellowstone national park0.500000
LOWER IN bacterial vaginosis0.500000
south florida0.500000
shark0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
thermophilic sediment0.500000
delphinus delphis0.500000
LOWER IN chronic rhinosinusitis0.500000
LOWER IN sinusitis0.500000
chuquisaca department0.500000
forearm0.500000
hong kong0.500000
crioceris duodecimpunctata0.500000
subway0.500000
bangladesh0.500000
siganidae0.500000
rabbitfish0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
southern united states0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.370000
homo sapiens0.370000
skin0.200000
air0.110000
pair of nares0.100000
adult0.090000
city0.060000
whole body0.060000
nasal cavity0.050000
belgium0.050000
dust0.050000
australia0.050000
mucus0.050000
poland0.050000
beetle0.050000
water0.050000
building0.040000
state of illinois0.040000
urban biome0.040000
new york city0.040000
state of california0.040000
LOWER IN mouth0.040000
plant0.040000
herbivorous beetle0.040000
duodenum0.040000
fresh water0.040000
state of florida0.040000
child0.040000
arm0.040000
inguinal region0.030000
axilla0.030000
amerindian0.030000
hunter gatherer0.030000
venezuela0.030000
finland0.030000
nasopharynx0.030000
snow0.030000
depth 0-5cm0.030000
sweden0.030000
floor0.030000
felis catus0.030000
LOWER IN saliva0.030000
canis lupus familiaris0.030000
foot0.030000
south africa0.030000
nida basin0.030000
research facility0.030000
bird0.030000
river0.030000
atlantic ocean0.030000
control0.030000
LOWER IN feces0.030000
age 5-13 years0.030000
bolivia0.030000
rural community0.030000
chuquisaca department0.030000
forearm0.030000
israel0.030000
size < 10um0.030000
bedroom0.020000
chicago0.020000
sebum0.020000
train0.020000
boston0.020000
contact lens0.020000
coral0.020000
skin of body0.020000
umbilicus0.020000
commonwealth of pennsylvania0.020000
age0.020000
infant0.020000
kingdom of the netherlands0.020000
lapland0.020000
kingdom of norway0.020000
anterior naris0.020000
male0.020000
diabetes mellitus0.020000
digestive system0.020000
centrocercus urophasianus0.020000
greater sage-grouse0.020000
state of wyoming0.020000
LOWER IN caecum0.020000
drinking water0.020000
tap water0.020000
depth 10 cm0.020000
north america0.020000
megaptera novaeangliae0.020000
humpback whale0.020000
respiratory airway0.020000
exhaled air condensate0.020000
whale blow0.020000
LOWER IN nasopharynx0.020000
bathroom0.020000
shower0.020000
tile0.020000
building wall0.020000
yellowstone national park0.020000
geothermal field0.020000
high temperature environment0.020000
vagina0.020000
Exp. ID User ID Description Date Region Flag Sequences
26amnon high in inguinal region axilla compared to pair of nares mucus in united states of america homo sapiens 2016-12-05v4No1 / 6
523amnondominant air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 10
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v4No1 / 11
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 21
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 23
621amnondominant ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 24
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 66
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229

Problems / suggestions? Please email info AT dbbact DOT org