Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGTCCACGGCTTAACTGTGGGATGGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
cold environment0.363636
gastrointestinal system mucosa0.300000
12c0.300000
skin0.270270
rainbow trout0.266667
oncorhynchus mykiss0.266667
rangifer tarandus0.222222
reindeer0.222222
african lion safari0.222222
LOWER IN warm temperature habitat0.222222
skin of body0.222222
umbilicus0.222222
hong kong0.222222
canada0.200000
commonwealth of pennsylvania0.166667
sweden0.148148
city0.146341
captive0.133333
LOWER IN feces0.133333
LOWER IN 18c0.125000
penis0.125000
male organism0.125000
gut content0.125000
temp 12c0.125000
LOWER IN temp 18c0.125000
subway0.125000
LOWER IN amerindian0.125000
LOWER IN hunter gatherer0.125000
LOWER IN venezuela0.125000
new delhi0.125000
chuquisaca department0.125000
forearm0.125000
fish0.121212
zoological garden0.117647
age 5-13 years0.117647
arm0.117647
small intestine0.111111
bolivia0.111111
air0.111111
south africa0.095238
india0.095238
male0.086957
duodenum0.086957
rural community0.086957
digestive system0.063492
child0.054054
homo sapiens0.051903
adult0.037267
united states of america0.019108
research facility0.017937
Fraction of dbbact annotations with this term covered by the query
TermScore
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
rangifer tarandus0.500000
reindeer0.500000
african lion safari0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
skin of body0.500000
umbilicus0.500000
penis0.500000
male organism0.500000
gut content0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
hong kong0.500000
subway0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
new delhi0.500000
chuquisaca department0.500000
forearm0.500000
canada0.333333
age 5-13 years0.333333
arm0.333333
rainbow trout0.250000
oncorhynchus mykiss0.250000
small intestine0.250000
bolivia0.250000
commonwealth of pennsylvania0.200000
skin0.185185
south africa0.142857
india0.142857
captive0.125000
LOWER IN feces0.125000
male0.111111
city0.111111
duodenum0.111111
rural community0.111111
sweden0.100000
zoological garden0.100000
air0.090909
fish0.076923
child0.043478
digestive system0.035714
homo sapiens0.027624
adult0.020408
united states of america0.010000
research facility0.009259
Fraction of annotations for the query sequences containing the term
TermScore
skin0.500000
homo sapiens0.428571
sweden0.285714
fish0.285714
rainbow trout0.285714
oncorhynchus mykiss0.285714
research facility0.285714
digestive system0.285714
cold environment0.285714
gastrointestinal system mucosa0.214286
12c0.214286
united states of america0.214286
adult0.214286
city0.214286
canada0.142857
captive0.142857
zoological garden0.142857
rangifer tarandus0.142857
reindeer0.142857
african lion safari0.142857
LOWER IN warm temperature habitat0.142857
skin of body0.142857
umbilicus0.142857
commonwealth of pennsylvania0.142857
air0.142857
hong kong0.142857
LOWER IN feces0.142857
LOWER IN 18c0.071429
penis0.071429
south africa0.071429
male organism0.071429
male0.071429
gut content0.071429
temp 12c0.071429
LOWER IN temp 18c0.071429
subway0.071429
LOWER IN amerindian0.071429
LOWER IN hunter gatherer0.071429
LOWER IN venezuela0.071429
new delhi0.071429
small intestine0.071429
duodenum0.071429
india0.071429
child0.071429
age 5-13 years0.071429
bolivia0.071429
rural community0.071429
chuquisaca department0.071429
arm0.071429
forearm0.071429
Exp. ID User ID Description Date Region Flag Sequences
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
565amnondominant skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 23
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org