Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGTCCACGGCTTAACTGTGGGATGGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
cold environment0.421053
gastrointestinal system mucosa0.352941
12c0.352941
rainbow trout0.296296
oncorhynchus mykiss0.296296
african lion safari0.266667
reindeer0.266667
rangifer tarandus0.266667
canada0.266667
LOWER IN warm temperature habitat0.266667
hong kong0.266667
skin0.180451
captive0.173913
sweden0.170213
city0.164384
LOWER IN 18c0.153846
gut content0.153846
temp 12c0.153846
LOWER IN temp 18c0.153846
subway0.153846
LOWER IN amerindian0.153846
LOWER IN hunter gatherer0.153846
LOWER IN venezuela0.153846
new delhi0.153846
chuquisaca department0.153846
forearm0.153846
LOWER IN feces0.153846
zoological garden0.148148
fish0.145455
age 5-13 years0.142857
arm0.142857
small intestine0.133333
bolivia0.133333
air0.121212
india0.111111
rural community0.111111
duodenum0.100000
digestive system0.067227
child0.064516
homo sapiens0.033708
research facility0.020050
united states of america0.010101
Fraction of dbbact annotations with this term covered by the query
TermScore
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
african lion safari0.500000
reindeer0.500000
rangifer tarandus0.500000
canada0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
gut content0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
hong kong0.500000
subway0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
new delhi0.500000
chuquisaca department0.500000
forearm0.500000
age 5-13 years0.333333
arm0.333333
rainbow trout0.250000
oncorhynchus mykiss0.250000
small intestine0.250000
bolivia0.250000
captive0.166667
india0.142857
rural community0.142857
LOWER IN feces0.133333
zoological garden0.125000
skin0.120000
city0.117647
sweden0.111111
duodenum0.111111
fish0.090909
air0.090909
child0.050000
digestive system0.037037
homo sapiens0.017964
research facility0.010309
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
sweden0.363636
fish0.363636
rainbow trout0.363636
oncorhynchus mykiss0.363636
research facility0.363636
digestive system0.363636
cold environment0.363636
skin0.363636
gastrointestinal system mucosa0.272727
12c0.272727
city0.272727
homo sapiens0.272727
african lion safari0.181818
reindeer0.181818
rangifer tarandus0.181818
zoological garden0.181818
captive0.181818
canada0.181818
LOWER IN warm temperature habitat0.181818
air0.181818
hong kong0.181818
LOWER IN feces0.181818
LOWER IN 18c0.090909
gut content0.090909
temp 12c0.090909
LOWER IN temp 18c0.090909
subway0.090909
united states of america0.090909
LOWER IN amerindian0.090909
LOWER IN hunter gatherer0.090909
LOWER IN venezuela0.090909
new delhi0.090909
small intestine0.090909
duodenum0.090909
india0.090909
child0.090909
age 5-13 years0.090909
bolivia0.090909
rural community0.090909
chuquisaca department0.090909
arm0.090909
forearm0.090909
Exp. ID User ID Description Date Region Flag Sequences
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
565amnonhighfreq african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
565amnoncommon african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 96
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org