Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTTGTTCGTGAAAACCGGGGGCTTAACCTCTGGCGTGCGGGCGATACGGGCAGACTGGAGTACTGCAGGGGAGACTGGAATTCCTGG

Taxonomy: d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Mycobacteriaceae;g__Mycobacterium

species # matches SILVA IDs
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
0-9 years of grazing exclusion0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
grazing exclusion0.500000
depth 40-60cm0.500000
27-35 years of grazing exclusion0.500000
LOWER IN depth 40-60cm0.500000
LOWER IN 0-9 years of grazing exclusion0.500000
depth 20-40cm0.333333
depth 10-20cm0.333333
root endosphere0.250000
rock0.125000
depth (soil) 0-10cm0.076923
LOWER IN depth (soil) 0-10cm0.076923
root0.066667
brazil0.052632
plant0.022727
rhizosphere0.021277
soil0.019802
china0.005405
Fraction of annotations for the query sequences containing the term
TermScore
soil0.705882
yunwushan national natural grassland protection zone0.647059
ningxia province0.647059
calci-orthic aridisol0.647059
haplic calcisol0.647059
grazing exclusion0.647059
china0.647059
minas gerais state0.352941
campos rupestres0.352941
brazil0.352941
27-35 years of grazing exclusion0.294118
0-9 years of grazing exclusion0.235294
depth 20-40cm0.176471
depth 10-20cm0.176471
depth (soil) 0-10cm0.176471
rhizosphere0.117647
vellozia epidendroides0.117647
root0.117647
barbacenia macrantha0.117647
depth 40-60cm0.117647
ph 3.50.058824
plant0.058824
rock0.058824
root endosphere0.058824
LOWER IN depth (soil) 0-10cm0.058824
LOWER IN depth 40-60cm0.058824
LOWER IN 0-9 years of grazing exclusion0.058824
Exp. ID User ID Description Date Region Flag Sequences
824sheryoHigher in soil at 0-10cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 294
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth (soil) 0-10cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 734
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903

Problems / suggestions? Please email info AT dbbact DOT org