Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTTGTTCGTGAAAACTCACAGCTTAACTGTGGGCGTGCGGGCGATACGGGCAGACTGGAGTACTGCAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.572434
rhizosphere0.279302
china0.259298
cultivated environment0.165517
united states of america0.151394
zea mays0.128312
silt loam0.117302
kellogg biological station0.112094
mesic type hapludalf0.112094
kalamazoo loam0.112094
depth (soil) 0-10cm0.108447
loess plateau0.104135
triticum aestivum0.096872
shaanxi province0.096096
depth (soil) 0-20cm0.091394
root0.091151
topsoil0.086705
agricultural field0.084367
citrus0.083333
united states0.079511
nicollet soil series0.079511
des moines0.079511
glycine max0.078471
state of michigan0.077393
forest ecosystem0.076471
iowa0.076471
farm0.074195
yunwushan national natural grassland protection zone0.073846
ningxia province0.073846
calci-orthic aridisol0.073846
haplic calcisol0.073846
grazing exclusion0.073846
robinia pseudoacacia0.073846
reforestation0.073846
oryza sativa0.072948
agricultural feature0.071889
desert0.068768
woodland area0.065395
paddy field soil0.063291
restored prairie0.062305
state of california0.058680
mexico0.057803
ph 7-80.057389
ph 60.057234
clay loam0.057234
wheat0.055641
jiangsu province0.052941
state of florida0.050704
mangrove swamp0.050473
cannabis sativa0.050473
zhejiang province0.048048
leaf0.047818
ph 6-70.045498
heilongjiang province0.044944
depth (soil) 0-5cm0.044944
ph 90.044944
agave0.044444
panicum virgatum0.044444
water0.043973
orchard0.042553
winter0.042440
canada0.041284
state of new york0.040404
skin0.040161
north china plain0.038339
guanajuato0.038339
miscanthus0.038339
20 years0.038339
river0.038047
corn0.037618
depth (soil) 25-50cm0.037618
tree0.036254
state of tennessee0.036254
fresh water0.035608
biofilm0.035294
marine sediment0.033333
root endosphere0.032503
hordeum vulgare0.032415
depth 10-20cm0.032415
rice0.032154
mangrove0.032154
greenhouse soil0.032154
chrysanthemum morifolium ramat.0.032154
chrysanthemum0.032154
nanjing county0.032154
low sodicity0.032154
salic solonetz0.032154
da'an station0.032154
songnen plain0.032154
kanawha0.032154
0-9 years of grazing exclusion0.032154
gleysol0.032154
sihong county0.032154
chenwei forest0.032154
poplar plantation0.032154
poplar0.032154
depth 0-40cm0.032154
bulk soil0.031983
sand0.031983
lake sediment0.031898
Fraction of dbbact annotations with this term covered by the query
TermScore
sarapiqui canton1.000000
cane toad1.000000
bufo marinus1.000000
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
root endosphere0.750000
cultivated environment0.750000
fen0.666667
particles0.666667
hordeum vulgare0.666667
ph 60.666667
ant0.666667
heilongjiang province0.666667
clay loam0.666667
paddy field soil0.666667
depth (soil) 0-5cm0.666667
chemical fertilization n,p,k0.666667
trichoderma guizhouense njau 47420.666667
ph 7.50.666667
ph 90.666667
ph 7.70.666667
depth 10-20cm0.666667
loess plateau0.666667
depth (sediment) 0-20cm0.666667
depth 5cm0.600000
triticum aestivum0.545455
root0.533333
rhizosphere0.531915
soil0.514851
maryland county0.500000
field soil0.500000
seleniferous0.500000
non-seleniferous0.500000
temperate grassland biome0.500000
peat soil0.500000
flooded grassland biome0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
urban biome0.500000
central park0.500000
merlot0.500000
grapevine0.500000
mississippi river0.500000
winter barley0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
taxus0.500000
temperate0.500000
taxus cuspidata0.500000
taxus mairei0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
slit loam0.500000
pinus sibirica0.500000
pine forest0.500000
effluent0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
turbidity0.500000
phyllosphere0.500000
kitchen0.500000
sink0.500000
LOWER IN bathroom0.500000
LOWER IN shower0.500000
LOWER IN tile0.500000
LOWER IN building wall0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
epilithic0.500000
arachis hypogaea0.500000
peanut0.500000
negev desert0.500000
LOWER IN heat stressed soil0.500000
soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
mangrove swamp0.500000
mangrove0.500000
avicennia germinans0.500000
rhizophora mangle0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
cabbage0.500000
state of rhode island0.500000
philippine sea0.500000
svalbard archipelago0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.644518
china0.411960
united states of america0.252492
rhizosphere0.189369
cultivated environment0.093023
zea mays0.076412
depth (soil) 0-20cm0.066445
silt loam0.066445
depth (soil) 0-10cm0.063123
state of michigan0.063123
kellogg biological station0.063123
mesic type hapludalf0.063123
kalamazoo loam0.063123
farm0.056478
agricultural field0.056478
loess plateau0.056478
triticum aestivum0.053156
shaanxi province0.053156
root0.049834
topsoil0.049834
citrus0.046512
forest ecosystem0.043189
glycine max0.043189
agricultural feature0.043189
united states0.043189
nicollet soil series0.043189
des moines0.043189
iowa0.043189
woodland area0.039867
oryza sativa0.039867
state of california0.039867
desert0.039867
yunwushan national natural grassland protection zone0.039867
ningxia province0.039867
calci-orthic aridisol0.039867
haplic calcisol0.039867
grazing exclusion0.039867
robinia pseudoacacia0.039867
reforestation0.039867
mexico0.033223
ph 7-80.033223
paddy field soil0.033223
restored prairie0.033223
state of florida0.029900
ph 60.029900
wheat0.029900
canada0.029900
clay loam0.029900
jiangsu province0.029900
leaf0.026578
water0.026578
research facility0.026578
mangrove swamp0.026578
winter0.026578
zhejiang province0.026578
ph 6-70.026578
cannabis sativa0.026578
state of new york0.023256
skin0.023256
agave0.023256
heilongjiang province0.023256
orchard0.023256
marine sediment0.023256
depth (soil) 0-5cm0.023256
ph 90.023256
panicum virgatum0.023256
river0.019934
fresh water0.019934
tree0.019934
biofilm0.019934
north china plain0.019934
guanajuato0.019934
state of tennessee0.019934
corn0.019934
depth (soil) 25-50cm0.019934
miscanthus0.019934
20 years0.019934
hordeum vulgare0.016611
sea water0.016611
rice0.016611
solanum lycopersicum0.016611
bulk soil0.016611
australia0.016611
sand0.016611
state of idaho0.016611
mangrove0.016611
root endosphere0.016611
greenhouse soil0.016611
biochar0.016611
ph 7.60.016611
ph 6.90.016611
chrysanthemum morifolium ramat.0.016611
chrysanthemum0.016611
nanjing county0.016611
low salinity0.016611
low sodicity0.016611
salic solonetz0.016611
da'an station0.016611
songnen plain0.016611
kanawha0.016611
Exp. ID User ID Description Date Region Flag Sequences
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 52
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in building urban biome united states of america )2017-10-01v4No1 / 61
921amnoncommon sarapiqui canton, costa rica, cane toad, bufo marinus, skin epidermis, skin2022-07-24v4No1 / 68
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
512amnon high in depth (soil) 10 cm depth (soil) 0-20cm compared to depth (soil) 60cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
196amnonlower in water compared to biofilm ( high in biofilm biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 100
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth (water) 0cm late time points in depth (water) 2000-5000m water mediterranean sea depth (water) 2000-3000m sea water )2019-03-05v4No1 / 132
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
887amnoncommon coral, porites lutea, great barrier reef, coral sea, australia2022-03-28v4No1 / 147
618amnon high in hash cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 152
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
784amnoncommon depth (soil) 0-5cm, common reed, phragmites australis, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 204
824sheryoHigher soil at 40-60cm depth after 0-9 years compared to 27-35 years after of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth 40-60cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 247
282amnoncommon soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
887amnoncommon australia, coral sea, great barrier reef, saline water, sea water2022-03-28v4No1 / 259
459amnoncommon in middle, bottom in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 352
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 369
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
784amnoncommon depth (soil) 0-5cm, saltmeadow cordgrass, sporobolus pumilus, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 382
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 390
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth (water) 10cm united states of america stream )2017-07-24v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth (water) 150m, sea water2018-05-28v4No1 / 397
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
618amnon high in hash cannabis plant compared to cbd yummy cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 416
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 431
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
347amnon high in depth (soil) 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
718amnon high in epilimnion compared to hypolimnion in freshwater lake bog lake united states of america state of wisconsin ph 4.5-5 dimictic lake "north sparkling bog" lake 2028-05-23v4No1 / 488
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
784amnoncommon depth (soil) 0-5cm, sporobolus alterniflorus, smooth cordgrass, spartina alterniflora, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 511
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth (water) 1000m)2017-04-18v4No1 / 566
160amnoncommon in wastewater treatment plant effluent in spring in china (common spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 573
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 595
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 598
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 650
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 667
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth (soil) 0-20cm depth 0cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 675
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 703
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth (soil) 0-10cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 734
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 760
357amnon high in ph>4 compared to ph<4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 761
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 764
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
900amnoncommon depth (water) 1m, stordalen mire, depth (sediment) 0-20cm, sweden, lake sediment, peatland2022-04-25v4No1 / 772
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 784
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 790
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 811
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 861
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
769sheryocommon in no tillage wheat field in northern israel (common bulk soil, soil, vertisol, israel, northen israel, no tillage, triticum aestivum)2021-04-18v4No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
900amnoncommon depth (water) 5m, stordalen mire, depth (sediment) 0-20cm, sweden, lake sediment, peatland2022-04-25v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in ph 9 low sodicity low salinity compared to ph 10 high sodicity high salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 895
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 989
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v4No1 / 993
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1128
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 1170
252amnoncommon in river sand biofilm (common biofilm, river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1346
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1354
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1765
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org