Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTTGTTCGTGAAATGCCACAGCTTAACTGTGGGCGTGCGGGCGATACGGGCAGACTGGAGTACTGCAGGGGAGACTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
soil0.332344
rhizosphere0.179409
minas gerais state0.171429
campos rupestres0.171429
mexico0.170213
state of idaho0.157895
brazil0.147239
forest ecosystem0.141176
topsoil0.141176
woodland area0.131868
guanajuato0.121212
desert0.102041
ph 6-6.50.093750
myrtillocactus geometrizans0.093750
opuntia robusta0.093750
red soil0.093750
mesocosm0.093750
27-35 years of grazing exclusion0.093750
yunwushan national natural grassland protection zone0.093750
ningxia province0.093750
calci-orthic aridisol0.093750
haplic calcisol0.093750
grazing exclusion0.093750
root0.090909
cultivated environment0.090909
cactus0.089552
semi-arid0.089552
cambisol0.089552
depth (soil) 0-10cm0.081301
hunan province0.075949
state of georgia0.073171
zea mays0.068182
triticum aestivum0.065934
soybean0.065574
non-seleniferous0.064516
arachis hypogaea0.064516
peanut0.064516
ph 5.50.064516
boechera stricta0.064516
moist tropical forest0.064516
agave0.064516
vellozia epidendroides0.064516
barbacenia macrantha0.064516
quzhou county0.064516
days 1800.064516
mature barley plants0.064516
severed branch0.064516
epiphytic material0.064516
olympic national park0.064516
canopy soil0.064516
alycaeus jagori0.064516
state of sabah0.064516
tundra0.063492
fertilized soil0.063492
province of quebec0.062500
pasture0.062500
hordeum vulgare0.062500
land snail0.062500
malaysia0.062500
glycine max0.061538
ph<50.060606
depth (soil) 15cm0.060606
ph 50.058824
ireland0.058824
state of washington0.058824
china0.057182
depth (soil) 0-20cm0.057143
LOWER IN rhizosphere0.057143
gastrointestinal system0.055556
farm0.052863
brassicaceae0.052632
LOWER IN leaf0.050633
zhejiang province0.048780
plant0.048387
ph 4-50.047619
stomach0.043478
united states of america0.042523
state of california0.035714
canada0.033898
LOWER IN seleniferous0.033333
root zone soil0.033333
pinus sibirica0.033333
pine forest0.033333
LOWER IN non-manured0.033333
LOWER IN soilwater0.033333
ph>4.50.033333
LOWER IN ph&lt;4.50.033333
subpolar coniferous forest biome0.033333
boreal forest0.033333
mediterranean forest biome0.033333
savanna0.033333
agave salmiana0.033333
LOWER IN agave0.033333
mature soil0.033333
ph 3.50.033333
elevation 1000-1100m0.033333
lushan mountain0.033333
LOWER IN cherokia georgiana georgiana0.033333
LOWER IN millipede0.033333
LOWER IN intact branch0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
soybean0.666667
non-seleniferous0.500000
LOWER IN seleniferous0.500000
ph 6-6.50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
pinus sibirica0.500000
pine forest0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN non-manured0.500000
LOWER IN soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph&lt;4.50.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
mediterranean forest biome0.500000
savanna0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
LOWER IN agave0.500000
red soil0.500000
mature soil0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
quzhou county0.500000
days 1800.500000
mature barley plants0.500000
elevation 1000-1100m0.500000
lushan mountain0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
LOWER IN intact branch0.500000
severed branch0.500000
epiphytic material0.500000
olympic national park0.500000
canopy soil0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
27-35 years of grazing exclusion0.500000
depth 40-60cm0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
grazing exclusion0.500000
LOWER IN 0-9 years of grazing exclusion0.500000
raphanus sativus0.500000
LOWER IN opisthostoma concinnum0.500000
LOWER IN plectostoma concinnum0.500000
alycaeus jagori0.500000
state of sabah0.500000
LOWER IN georissa similis0.500000
LOWER IN georissa0.500000
tundra0.400000
fertilized soil0.400000
cultivated environment0.375000
LOWER IN selenium0.333333
cactus0.333333
semi-arid0.333333
siberia0.333333
province of quebec0.333333
state of idaho0.333333
LOWER IN soybean0.333333
cambisol0.333333
nenets autonomous okrug0.333333
ph 4-60.333333
pasture0.333333
hordeum vulgare0.333333
coniferous forest biome0.333333
LOWER IN plant litter0.333333
LOWER IN depth (soil) 10-25cm0.333333
depth (soil) 25-50cm0.333333
corn0.333333
depth 20-40cm0.333333
LOWER IN silty clay loam0.333333
sandy loam0.333333
radish0.333333
land snail0.333333
malaysia0.333333
glycine max0.285714
ph 40.250000
LOWER IN root structure0.250000
non-manured soil0.250000
ph<50.250000
LOWER IN ph&gt;50.250000
orchard0.250000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.827586
united states of america0.258621
china0.241379
rhizosphere0.189655
mexico0.137931
brazil0.137931
woodland area0.103448
forest ecosystem0.103448
state of idaho0.103448
topsoil0.103448
minas gerais state0.103448
campos rupestres0.103448
depth (soil) 0-10cm0.086207
desert0.086207
root0.068966
depth (soil) 0-20cm0.068966
guanajuato0.068966
ph 6-6.50.051724
myrtillocactus geometrizans0.051724
opuntia robusta0.051724
cactus0.051724
semi-arid0.051724
LOWER IN rhizosphere0.051724
plant0.051724
cultivated environment0.051724
hunan province0.051724
red soil0.051724
cambisol0.051724
zea mays0.051724
triticum aestivum0.051724
farm0.051724
mesocosm0.051724
state of georgia0.051724
27-35 years of grazing exclusion0.051724
yunwushan national natural grassland protection zone0.051724
ningxia province0.051724
calci-orthic aridisol0.051724
haplic calcisol0.051724
grazing exclusion0.051724
non-seleniferous0.034483
tundra0.034483
ph 50.034483
arachis hypogaea0.034483
peanut0.034483
fertilized soil0.034483
canada0.034483
province of quebec0.034483
ph 5.50.034483
brassicaceae0.034483
boechera stricta0.034483
LOWER IN leaf0.034483
glycine max0.034483
soybean0.034483
moist tropical forest0.034483
state of california0.034483
agave0.034483
ph<50.034483
pasture0.034483
ireland0.034483
vellozia epidendroides0.034483
barbacenia macrantha0.034483
zhejiang province0.034483
quzhou county0.034483
depth (soil) 15cm0.034483
ph 4-50.034483
hordeum vulgare0.034483
days 1800.034483
mature barley plants0.034483
severed branch0.034483
epiphytic material0.034483
state of washington0.034483
olympic national park0.034483
canopy soil0.034483
alycaeus jagori0.034483
land snail0.034483
stomach0.034483
gastrointestinal system0.034483
malaysia0.034483
state of sabah0.034483
LOWER IN selenium0.017241
LOWER IN seleniferous0.017241
state of florida0.017241
root zone soil0.017241
pinus sibirica0.017241
pine forest0.017241
ph 40.017241
siberia0.017241
manured soil0.017241
LOWER IN non-manured0.017241
LOWER IN soilwater0.017241
LOWER IN water0.017241
ph 6.50.017241
ph 60.017241
LOWER IN glycine max0.017241
LOWER IN soybean0.017241
LOWER IN root structure0.017241
LOWER IN root0.017241
ph>4.50.017241
LOWER IN ph&lt;4.50.017241
subpolar coniferous forest biome0.017241
Exp. ID User ID Description Date Region Flag Sequences
480amnon high in ireland compared to new zealand in soil pasture farm ph 6-7 2019-02-05v4No1 / 94
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
129amnon high in soil compared to rhizosphere in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 221
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 299
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 768
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1698
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org