Search result for sequence:
TACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTGTGTCGCGTCGGCCGTGAAAACCTGGGGCTCAACTCTGGGCGTGCGGTCGATACGGGCATCACTTGAGTTCGGCAGGGGAGACTGGAATTCCTG
common ontology terms
term enrichment score
TermScore
skin0.239041
soil0.207524
leaf0.205128
stem0.141818
rhizosphere0.127971
united states of america0.123917
southern united states0.115607
state of sabah0.115607
state of idaho0.109290
snake0.109290
malaysia0.109290
land snail0.109290
minas gerais state0.094675
campos rupestres0.094675
alycaeus jagori0.094675
gastrointestinal system0.089686
wild0.085106
mexico0.084656
plant0.078140
brazil0.075472
populus0.072727
state of north carolina0.071795
citrus0.071429
bulk soil0.068966
root0.065574
state of tennessee0.065574
zhejiang province0.063492
leaf surface0.061983
stomach0.061920
boechera stricta0.061350
urocyon littoralis catalinae0.061350
santa catalina island fox0.061350
urocyon littoralis0.061350
mature barley plants0.061350
days 1800.061350
quzhou county0.061350
LOWER IN georissa similis0.061350
LOWER IN georissa0.061350
belgium0.060120
cultivated environment0.059701
santa catalina island0.059524
hordeum vulgare0.059524
state of florida0.057971
depth (soil) 15cm0.057803
tree0.056338
state of california0.053548
china0.052359
desert0.051813
brassicaceae0.050505
urban biome0.049689
myrtillocactus geometrizans0.049689
opuntia robusta0.049689
cambridgeshire0.049689
guanajuato0.049689
agave0.049689
barbacenia macrantha0.049689
external acoustic meatus0.049689
LOWER IN opisthostoma concinnum0.049689
LOWER IN plectostoma concinnum0.049689
cactus0.048485
semi-arid0.048485
newt0.048485
pair of nares0.047904
austria0.046784
ph 4-50.045872
woodland area0.045714
depth (soil) 0-10cm0.044693
canada0.043716
arm0.038095
hedera hibernica0.037736
ivy0.037736
epiphytic material0.037736
olympic national park0.037736
canopy soil0.037736
thyrow0.037736
albic luvisol0.037736
lettuce0.037736
foot0.037037
commonwealth of virginia0.036364
rock0.036364
ear canal0.036364
pot expreiment0.036364
forest ecosystem0.036036
state of washington0.035714
homo sapiens0.035345
air0.034783
biochar0.033898
united kingdom0.032129
farm0.031579
fresh water0.030303
building0.028986
australia0.025641
venezuela0.025641
amerindian0.025641
maryland county0.025478
non-seleniferous0.025478
quincy, fl0.025478
ph 6-6.50.025478
bathroom0.025478
shower0.025478
Fraction of dbbact annotations with this term covered by the query
TermScore
turrialba canton1.000000
cane toad1.000000
rhinella marina1.000000
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-nĂșcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
ear1.000000
department of peten1.000000
arm0.666667
venezuela0.666667
amerindian0.666667
leaf surface0.600000
maryland county0.500000
coffea arabica0.500000
dry processing0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
seleniferous0.500000
junco hyemalis0.500000
songbird0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
immokalee, fl0.500000
gainesville, fl0.500000
pseudacris crucifer0.500000
peeper0.500000
anaxyrus americanus0.500000
american toad0.500000
urban biome0.500000
central park0.500000
hedera hibernica0.500000
ivy0.500000
moor0.500000
scrubland0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
kitchen0.500000
sink0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
quarry0.500000
greenschist0.500000
depth 2.5cm0.500000
size < 10um0.500000
clear day0.500000
dust storm0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
grassland0.500000
steppe0.500000
north china plain0.500000
ph>5, ph<60.500000
state of rhode island0.500000
food processing factory0.500000
LOWER IN stagnant water0.500000
apple0.500000
malus x domestica0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
mediterranean forest biome0.500000
savanna0.500000
guanajuato0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
aechmea eurycorymbus0.500000
dracaena draco0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
site 20.500000
LOWER IN site 10.500000
tsuga canadensis0.500000
eastern hemlock0.500000
tsuga dumosa0.500000
himalayan hemlock0.500000
tsuga sieboldii0.500000
southern japanese hemlock0.500000
tsuga chinensis0.500000
chinese hemlock0.500000
lower mississippi river0.500000
outdoor0.500000
LOWER IN indoor0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.398693
soil0.248366
skin0.189542
leaf0.130719
rhizosphere0.091503
plant0.091503
china0.084967
stem0.084967
homo sapiens0.065359
state of idaho0.065359
snake0.065359
southern united states0.065359
state of sabah0.065359
malaysia0.065359
gastrointestinal system0.065359
stomach0.065359
land snail0.065359
wild0.058824
brazil0.058824
mexico0.052288
minas gerais state0.052288
campos rupestres0.052288
alycaeus jagori0.052288
state of north carolina0.045752
state of florida0.039216
citrus0.039216
root0.039216
adult0.039216
state of tennessee0.039216
populus0.039216
tree0.039216
cultivated environment0.039216
zhejiang province0.039216
bulk soil0.039216
belgium0.032680
brassicaceae0.032680
boechera stricta0.032680
leaf surface0.032680
desert0.032680
state of california0.032680
urocyon littoralis catalinae0.032680
santa catalina island fox0.032680
santa catalina island0.032680
urocyon littoralis0.032680
mature barley plants0.032680
days 1800.032680
hordeum vulgare0.032680
ph 4-50.032680
depth (soil) 15cm0.032680
quzhou county0.032680
LOWER IN georissa similis0.032680
LOWER IN georissa0.032680
woodland area0.026144
urban biome0.026144
myrtillocactus geometrizans0.026144
opuntia robusta0.026144
cactus0.026144
semi-arid0.026144
pair of nares0.026144
canada0.026144
newt0.026144
cambridgeshire0.026144
united kingdom0.026144
depth (soil) 0-10cm0.026144
guanajuato0.026144
agave0.026144
austria0.026144
barbacenia macrantha0.026144
external acoustic meatus0.026144
LOWER IN opisthostoma concinnum0.026144
LOWER IN plectostoma concinnum0.026144
control0.019608
arm0.019608
commonwealth of virginia0.019608
hedera hibernica0.019608
ivy0.019608
forest ecosystem0.019608
farm0.019608
building0.019608
rock0.019608
air0.019608
australia0.019608
foot0.019608
water0.019608
fresh water0.019608
ear canal0.019608
biochar0.019608
epiphytic material0.019608
state of washington0.019608
olympic national park0.019608
canopy soil0.019608
germany0.019608
thyrow0.019608
albic luvisol0.019608
lettuce0.019608
pot expreiment0.019608
maryland county0.013072
venezuela0.013072
amerindian0.013072
hunter gatherer0.013072
Exp. ID User ID Description Date Region Flag Sequences
536amnondominant snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 12
432amnondominant united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
432amnondominant united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
981amnoncommon external acoustic meatus, ear, howler monkey, department of peten, guatemala, wild, monkey, alouatta pigra2022-12-25v3No1 / 21
432amnondominant united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
460amnonlower in occupied indoor air compared to outdoor air ( high in outdoor compared to indoor office in air united states of america state of california )2019-01-12v4No1 / 25
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 30
696amnoncommon helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 43
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 105
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
361amnoncommon leaf, austria, greenhouse, plant, aechmea eurycorymbus2018-08-21v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
628sheryoHigher in bulk soil with barley plants after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 140
921amnoncommon turrialba canton, cane toad, rhinella marina, skin epidermis, costa rica, skin2022-07-24v4No1 / 153
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
894amnoncommon leaf surface, citrus unshiu, china, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 172
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No2 / 477
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
426amnon high in site 2 compared to site 1 in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 228
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
205amnoncommon in Ely Greenstone rock piles (common rock, united states of america, quarry, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-nĂșcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 374
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No4 / 1672
696amnon high in alycaeus jagori compared to georissa similis georissa in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No4 / 1698
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
696amnon high in opisthostoma concinnum plectostoma concinnum compared to georissa georissa similis in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 606
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 628
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 768
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in particles mississippi river water river fresh water depth (water) 1m united states of america filtered 2.7um )2019-01-07v4No1 / 1418
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
665amnon high in inlet compared to outlet in late time points engineered wetland benthic biomat state of california water treatment pond microbial biomat biomat united states of america 2020-09-23v4No1 / 1629
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 2266
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770

Problems / suggestions? Please email info AT dbbact DOT org