Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.625936
adult0.297297
united states of america0.285889
saliva0.236349
child0.188580
feces0.178292
mouth0.138842
china0.129660
skin0.129630
dentition0.128825
infant0.115870
subgingival plaque0.100993
australia0.088189
nasopharynx0.087730
control0.076589
research facility0.075180
state of california0.074977
brazil0.066667
city0.064855
pair of nares0.058423
nasal cavity0.054773
felis catus0.053985
sweden0.052566
tongue0.051767
duodenum0.051040
larval stage0.050567
mouth mucosa0.047809
air0.047244
germany0.046875
costa rica0.046693
belgium0.046693
cat0.046512
poland0.044595
hunter gatherer0.043941
breast milk0.043622
perth0.043307
bolivia0.043307
czech republic0.042997
age 1-3 years0.042389
LOWER IN control0.041534
age0.040873
venezuela0.039920
amerindian0.039920
rural community0.039331
water0.036931
canada0.036364
lung0.036232
finland0.036101
oral cavity0.035874
recurrent otitis media0.035714
obsolete_juvenile stage0.035714
state of florida0.033898
bronchial epithelium0.032258
ant0.031873
kingdom of spain0.031571
stomach0.031471
africa0.031373
beetle0.031373
italy0.031048
kingdom of the netherlands0.030888
leaf0.030888
female0.030156
whole body0.029963
south korea0.028297
hospital0.028197
chuquisaca department0.028000
LOWER IN feces0.027741
age 5-13 years0.027613
united kingdom0.027613
river0.027613
canis lupus familiaris0.027537
new york city0.027237
bird0.027237
atlantic ocean0.027237
mucus0.026515
supragingival plaque0.024291
dermal layer of tongue0.024096
centrocercus urophasianus0.024096
greater sage-grouse0.024096
state of wyoming0.024096
south florida0.024096
shark0.024096
india0.024000
LOWER IN caecum0.023981
kingdom of denmark0.023669
bronchoalveolar lavage0.020298
building0.020263
arm0.020263
male0.020202
urban biome0.020161
shallow pocket depth0.020161
depth < 3mm0.020161
late adult stage0.020161
age 7-14 years0.020161
stunted growth0.020161
herbivorous beetle0.020161
shanghai proper0.019960
desert0.019861
plant0.019763
sea water0.019148
Fraction of dbbact annotations with this term covered by the query
TermScore
poland1.500000
canada1.000000
subgingival plaque0.900000
lung0.833333
saliva0.827586
dentition0.812500
tongue0.800000
bronchial epithelium0.800000
south korea0.800000
LOWER IN dentition0.800000
mouth mucosa0.750000
hunter gatherer0.750000
bronchoalveolar lavage0.750000
supragingival plaque0.750000
small village0.750000
finland0.714286
LOWER IN male0.666667
hospital0.666667
conjunctiva0.666667
building0.666667
state of illinois0.666667
sinusoidal space0.666667
paranasal sinus0.666667
dust0.666667
sputum0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
oral wash0.666667
tanzania0.666667
state of new york0.666667
bronchus0.666667
trachea0.666667
nectar0.666667
age < 3 years0.666667
graz city district0.666667
endosphere0.666667
age 1 week0.666667
foot0.666667
atlanta0.666667
jejunum0.666667
puerto rico0.666667
state of oklahoma0.666667
stream0.666667
LOWER IN supragingival plaque0.666667
infant0.631579
homo sapiens0.624309
mouth0.619048
breast milk0.600000
nasopharynx0.600000
age < 1 year0.600000
urine0.600000
flower0.600000
oral cavity0.571429
child0.565217
nasal cavity0.555556
duodenum0.555556
male0.555556
air0.545455
pair of nares0.545455
skin0.518519
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age &gt;=7 days0.500000
perth0.500000
recurrent otitis media0.500000
middle ear rinse0.500000
external acoustic meatus0.500000
ear canal0.500000
ant0.500000
bolivia0.500000
chuquisaca department0.500000
age 3 months0.500000
drosophila melanogaster0.500000
fruit fly0.500000
middle ear fluid0.500000
LOWER IN chronic gastritis0.500000
pseudomyrmex elongatus0.500000
bedroom0.500000
urban biome0.500000
train0.500000
boston0.500000
induced sputum0.500000
pseudomyrmex nigrocinctus0.500000
pseudomyrmex pallidus0.500000
outdoor0.500000
maxillary sinus0.500000
ethmoid sinus0.500000
hypopharynx0.500000
lower back0.500000
indoor0.500000
office0.500000
forearm0.500000
anterior naris0.500000
skin of face0.500000
skin under eyes0.500000
idiopathic pulmonary fibrosis0.500000
morning0.500000
slovak republic0.500000
age 21-28 years0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.627572
united states of america0.281893
adult0.222222
feces0.150206
saliva0.137860
child0.113169
china0.098765
mouth0.078189
skin0.074074
dentition0.069959
infant0.063786
control0.053498
subgingival plaque0.053498
australia0.049383
research facility0.049383
nasopharynx0.047325
state of california0.041152
brazil0.037037
city0.034979
pair of nares0.030864
nasal cavity0.028807
felis catus0.028807
sweden0.028807
tongue0.026749
larval stage0.026749
LOWER IN control0.026749
duodenum0.026749
costa rica0.024691
mouth mucosa0.024691
cat0.024691
air0.024691
belgium0.024691
germany0.024691
breast milk0.022634
age0.022634
age 1-3 years0.022634
perth0.022634
bolivia0.022634
hunter gatherer0.022634
czech republic0.022634
poland0.022634
rural community0.020576
venezuela0.020576
amerindian0.020576
water0.020576
finland0.018519
recurrent otitis media0.018519
canada0.018519
lung0.018519
oral cavity0.018519
obsolete_juvenile stage0.018519
state of florida0.018519
female0.016461
kingdom of the netherlands0.016461
kingdom of spain0.016461
ant0.016461
stomach0.016461
italy0.016461
bronchial epithelium0.016461
africa0.016461
whole body0.016461
beetle0.016461
leaf0.016461
age 5-13 years0.014403
chuquisaca department0.014403
united kingdom0.014403
hospital0.014403
new york city0.014403
mucus0.014403
south korea0.014403
canis lupus familiaris0.014403
LOWER IN feces0.014403
bird0.014403
river0.014403
atlantic ocean0.014403
kingdom of denmark0.012346
LOWER IN caecum0.012346
india0.012346
supragingival plaque0.012346
dermal layer of tongue0.012346
centrocercus urophasianus0.012346
greater sage-grouse0.012346
state of wyoming0.012346
south florida0.012346
shark0.012346
building0.010288
urban biome0.010288
arm0.010288
bronchoalveolar lavage0.010288
shallow pocket depth0.010288
depth < 3mm0.010288
late adult stage0.010288
sea water0.010288
shanghai proper0.010288
age 7-14 years0.010288
periodontitis0.010288
stunted growth0.010288
plant0.010288
herbivorous beetle0.010288
male0.010288
Exp. ID User ID Description Date Region Flag Sequences
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 6
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
605amnoncommon australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 6
605amnoncommon australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v3No1 / 6
605amnoncommon australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v3No1 / 7
284amnon high in age 2 months compared to age 1 year in homo sapiens female feces state of california infant 2018-01-27v4No1 / 8
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 8
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
565amnondominant skin, canada, felis catus, cat2019-11-21v3No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 9
244amnondominant drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
391amnoncommon feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 9
605amnoncommon australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 1 year)2017-10-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 10
523amnondominant air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 10
605amnondominant australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 10
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 11
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
567amnoncommon belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 11
26amnondominant homo sapiens, united states of america, pair of nares, mucus2016-12-05v4No1 / 12
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 12
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
460amnonhigh freq. in outdoor air (dominant air, united states of america, state of california, outdoor)2019-01-12v4No1 / 12
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
596amnondominant homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 12
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v3No1 / 12
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (dominant skin, homo sapiens)2017-02-15v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (dominant air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 13
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
567amnondominant belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 13
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 13
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v3No1 / 13
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
158amnondominant cat, felis catus, united states of america, conjunctiva2017-07-06v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
277amnondominant homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 14
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
546amnondominant homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in homo sapiens child age 2-4 years italy feces 2019-11-18v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 14
605amnoncommon australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
605amnondominant australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant cloud, french republic, air, autumn)2017-11-22v4No1 / 15
335amnondominant homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
596amnondominant homo sapiens, sweden, saliva, child, age 7 years2020-03-17v3No1 / 15
613amnondominant olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 15
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnondominant homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 16
598amnondominant child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 16
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
158amnondominant cat, felis catus, united states of america, axilla2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
277amnondominant homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 17
278amnondominant homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
418amnondominant coral, ocean, acropora hyacinthus, skeleton2018-12-02v4No1 / 17
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 17
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 18
519amnondominant homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
54amnondominant homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 19
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 19
105amnondominant brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnondominant homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 21
278amnondominant homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 21
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 21
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
576amnondominant homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 21
596amnoncommon homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 21
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
96amnondominant homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 22
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens czech republic adult 2020-01-09v3No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 23
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 24
260amnondominant homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 24
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
554amnondominant homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 25
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 26
104amnondominant homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 27
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
596amnon high in age 2 years compared to age 7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
79amnoncommon skin, united states of america, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
596amnoncommon homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
596amnoncommon homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 36
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
596amnoncommon homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
596amnoncommon homo sapiens, sweden, saliva, child, age 7 years2020-03-17v3No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 60
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
576amnoncommon homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
576amnoncommon homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
576amnoncommon homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 74
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 77
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 78
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 83
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in atlantic ocean south florida state of florida united states of america shark )2018-04-24v4No1 / 98
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
483amnoncommon larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-13v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
598amnoncommon child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 143
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
605amnon high in recurrent otitis media compared to control in australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 149
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
615amnon high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 306
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v4No1 / 368
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1071
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org