Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.620800
united states of america0.321466
adult0.276220
saliva0.210305
feces0.186352
mouth0.161201
dentition0.150366
child0.130526
china0.130007
skin0.126850
infant0.125962
subgingival plaque0.117677
state of california0.086862
research facility0.080531
city0.070819
nasal cavity0.063898
control0.063174
brazil0.060606
pair of nares0.059578
duodenum0.059578
larval stage0.058935
australia0.058361
air0.055172
costa rica0.054920
nasopharynx0.054422
felis catus0.053452
hunter gatherer0.051442
breast milk0.051005
bolivia0.050575
age0.047286
venezuela0.046729
amerindian0.046729
rural community0.046458
cat0.044150
lung0.042473
finland0.042293
poland0.042204
obsolete_juvenile stage0.041763
LOWER IN control0.041199
state of florida0.039823
water0.038731
bronchial epithelium0.037825
ant0.037296
africa0.037296
kingdom of the netherlands0.036613
beetle0.036613
italy0.036391
whole body0.035955
female0.035499
hospital0.033058
chuquisaca department0.032787
oral cavity0.032787
LOWER IN feces0.032520
age 5-13 years0.032258
united kingdom0.032258
belgium0.032258
river0.032258
bird0.032000
new york city0.031746
atlantic ocean0.031746
mucus0.030769
supragingival plaque0.028504
mouth mucosa0.028436
LOWER IN caecum0.028235
india0.028235
centrocercus urophasianus0.028235
greater sage-grouse0.028235
state of wyoming0.028235
south florida0.028235
shark0.028235
germany0.027939
stomach0.027842
kingdom of denmark0.027842
canis lupus familiaris0.027650
leaf0.027180
bronchoalveolar lavage0.023828
building0.023781
arm0.023781
urban biome0.023641
shallow pocket depth0.023641
depth < 3mm0.023641
late adult stage0.023641
age 7-14 years0.023641
stunted growth0.023641
herbivorous beetle0.023641
shanghai proper0.023364
desert0.023229
plant0.023095
sea water0.022259
periodontitis0.021834
LOWER IN dentition0.019139
tongue0.019093
conjunctiva0.019093
sinusoidal space0.019093
paranasal sinus0.019093
sputum0.019093
oral wash0.019093
state of new york0.019093
bronchus0.019093
trachea0.019093
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.500000
subgingival plaque0.900000
dentition0.866667
lung0.833333
saliva0.800000
bronchial epithelium0.800000
LOWER IN dentition0.800000
hunter gatherer0.750000
bronchoalveolar lavage0.750000
supragingival plaque0.750000
small village0.750000
finland0.714286
mouth mucosa0.666667
hospital0.666667
tongue0.666667
conjunctiva0.666667
building0.666667
state of illinois0.666667
sinusoidal space0.666667
paranasal sinus0.666667
dust0.666667
sputum0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
oral wash0.666667
tanzania0.666667
state of new york0.666667
bronchus0.666667
trachea0.666667
axilla0.666667
nectar0.666667
poland0.666667
age < 3 years0.666667
graz city district0.666667
age 1 week0.666667
foot0.666667
atlanta0.666667
jejunum0.666667
puerto rico0.666667
state of oklahoma0.666667
stream0.666667
LOWER IN supragingival plaque0.666667
mouth0.650000
homo sapiens0.624204
infant0.611111
breast milk0.600000
age < 1 year0.600000
urine0.600000
flower0.600000
rural community0.571429
nasal cavity0.555556
pair of nares0.555556
duodenum0.555556
air0.545455
amsterdam0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age >=7 days0.500000
ant0.500000
costa rica0.500000
child0.500000
bolivia0.500000
chuquisaca department0.500000
drosophila melanogaster0.500000
fruit fly0.500000
LOWER IN chronic gastritis0.500000
pseudomyrmex elongatus0.500000
bedroom0.500000
chicago0.500000
urban biome0.500000
train0.500000
boston0.500000
induced sputum0.500000
pseudomyrmex nigrocinctus0.500000
pseudomyrmex pallidus0.500000
skin0.500000
oral cavity0.500000
outdoor0.500000
hypopharynx0.500000
lower back0.500000
indoor0.500000
office0.500000
forearm0.500000
skin of face0.500000
skin under eyes0.500000
LOWER IN caecum0.500000
idiopathic pulmonary fibrosis0.500000
morning0.500000
slovak republic0.500000
age 21-28 years0.500000
age 2-4 years0.500000
contact lens0.500000
cloud0.500000
bronchial brush0.500000
shallow pocket depth0.500000
depth < 3mm0.500000
inguinal region0.500000
groin0.500000
commonwealth of pennsylvania0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.617433
united states of america0.331719
adult0.200969
feces0.162228
saliva0.121065
china0.096852
mouth0.092010
dentition0.082324
child0.075061
skin0.072639
infant0.070218
subgingival plaque0.062954
research facility0.053269
state of california0.048426
control0.043584
city0.038741
nasal cavity0.033898
brazil0.033898
larval stage0.031477
australia0.031477
pair of nares0.031477
duodenum0.031477
nasopharynx0.029056
costa rica0.029056
air0.029056
felis catus0.029056
breast milk0.026634
age0.026634
bolivia0.026634
hunter gatherer0.026634
LOWER IN control0.026634
rural community0.024213
venezuela0.024213
amerindian0.024213
cat0.024213
finland0.021792
lung0.021792
water0.021792
obsolete_juvenile stage0.021792
poland0.021792
state of florida0.021792
female0.019370
kingdom of the netherlands0.019370
ant0.019370
italy0.019370
bronchial epithelium0.019370
africa0.019370
whole body0.019370
beetle0.019370
age 5-13 years0.016949
chuquisaca department0.016949
united kingdom0.016949
hospital0.016949
new york city0.016949
mucus0.016949
oral cavity0.016949
belgium0.016949
LOWER IN feces0.016949
bird0.016949
river0.016949
atlantic ocean0.016949
stomach0.014528
mouth mucosa0.014528
kingdom of denmark0.014528
germany0.014528
LOWER IN caecum0.014528
india0.014528
supragingival plaque0.014528
canis lupus familiaris0.014528
centrocercus urophasianus0.014528
greater sage-grouse0.014528
state of wyoming0.014528
leaf0.014528
south florida0.014528
shark0.014528
building0.012107
urban biome0.012107
arm0.012107
bronchoalveolar lavage0.012107
shallow pocket depth0.012107
depth < 3mm0.012107
late adult stage0.012107
sea water0.012107
shanghai proper0.012107
age 7-14 years0.012107
periodontitis0.012107
stunted growth0.012107
plant0.012107
herbivorous beetle0.012107
desert0.012107
kingdom of spain0.009685
digestive system0.009685
age < 1 year0.009685
diarrhea0.009685
tongue0.009685
conjunctiva0.009685
LOWER IN periodontitis0.009685
sinusoidal space0.009685
paranasal sinus0.009685
sputum0.009685
Exp. ID User ID Description Date Region Flag Sequences
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
245amnonhighfreq homo sapiens, breast milk, finland2017-11-21v4No1 / 4
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 6
245amnonhighfreq homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
284amnon high in age 2 months compared to age 1 year in homo sapiens female feces state of california infant 2018-01-27v4No1 / 8
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 8
517amnonhighfreq homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 9
244amnonhighfreq drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 9
245amnonhighfreq homo sapiens, breast milk, china2017-11-21v4No1 / 9
391amnoncommon feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
58amnonhighfreq homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (highfreq homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 1 year)2017-10-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 10
523amnonhighfreq air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 10
133amnonhigh freq. in infants 0-1 years (highfreq homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (highfreq city, urban biome, train, boston)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (highfreq homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (highfreq united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 11
354amnonhighfreq homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnonhighfreq ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
26amnonhighfreq homo sapiens, united states of america, pair of nares, mucus2016-12-05v4No1 / 12
75amnonhighfreq homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (highfreq homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 12
335amnonhigh freq. in mouthwash (highfreq homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnonhighfreq homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
460amnonhigh freq. in outdoor air (highfreq air, united states of america, state of california, outdoor)2019-01-12v4No1 / 12
35amnonhighfreq tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
48amnonhighfreq homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (highfreq skin, homo sapiens)2017-02-15v4No1 / 13
158amnonhighfreq united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
408amnonhighfreq ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (highfreq air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 13
516amnonhighfreq homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
517amnonhighfreq homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
58amnonhighfreq homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
158amnonhighfreq cat, felis catus, united states of america, conjunctiva2017-07-06v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
245amnonhighfreq homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
277amnonhighfreq homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
469amnonhighfreq homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
546amnonhighfreq homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in feces italy age 2-4 years child homo sapiens 2019-11-18v3No1 / 14
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
58amnonhighfreq homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (highfreq homo sapiens, saliva)2017-02-15v4No1 / 15
64amnonhighfreq saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (highfreq cloud, french republic, air, autumn)2017-11-22v4No1 / 15
335amnonhighfreq homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
354amnonhighfreq homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
371amnonhighfreq homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
378amnonhighfreq homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
524amnonhighfreq homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
106amnonhighfreq homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
158amnonhighfreq united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
319amnonhighfreq homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
348amnonhighfreq homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnonhighfreq homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
519amnonhighfreq homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
32amnonhighfreq homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnonhighfreq homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
87amnonhighfreq homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
158amnonhighfreq cat, felis catus, united states of america, axilla2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (highfreq homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
277amnonhighfreq homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 17
278amnonhighfreq homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
418amnonhighfreq coral, ocean, acropora hyacinthus, skeleton2018-12-02v4No1 / 17
418amnonhighfreq coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnonhighfreq homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (highfreq homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
362amnonhighfreq hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 18
519amnonhighfreq homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
555amnonhighfreq homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
54amnonhighfreq homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
66amnonhighfreq homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
299amnonhighfreq saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
555amnonhighfreq homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 19
105amnonhighfreq brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (highfreq homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (highfreq saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (highfreq homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (highfreq homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
33amnonhighfreq homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
75amnonhighfreq homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (highfreq homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnonhighfreq homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 21
278amnonhighfreq homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 21
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon costa rica, psiguria triphylla, flower, nectar2019-03-08v4No1 / 21
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 21
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
96amnonhighfreq homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 22
378amnonhighfreq homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
425amnonhighfreq homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
455amnonhighfreq homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
425amnonhighfreq homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
173amnonhighfreq homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnonhighfreq homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 24
260amnonhighfreq homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 24
378amnonhighfreq homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
554amnonhighfreq homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (highfreq homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
425amnonhighfreq homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
104amnonhighfreq homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 27
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
3amnonhighfreq homo sapiens, tongue, china2016-10-06v4No1 / 30
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
79amnoncommon skin, united states of america, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 78
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in atlantic ocean south florida state of florida united states of america shark )2018-04-24v4No1 / 98
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
483amnoncommon larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-13v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
563amnoncommon control, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 170
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v4No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1071
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org