Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
sus scrofa0.264775
pig0.264775
farm0.256410
feces0.233923
caecum0.223776
wild0.201236
china0.193279
gallus gallus0.162476
chicken0.162476
canada0.133333
skin0.132953
urocyon littoralis catalinae0.129032
santa catalina island fox0.129032
santa catalina island0.129032
urocyon littoralis0.129032
homo sapiens0.128917
zoological garden0.128155
kingdom of spain0.109453
broiler chicken0.105960
adult0.099565
monkey0.091106
canis lupus familiaris0.088945
united states of america0.088531
state of michigan0.087774
LOWER IN united states of america0.080808
costa rica0.080537
dog0.078431
cebus capucinus0.070175
white-faced capuchin0.070175
thailand0.070175
india0.069565
free range chicken0.068966
rectum0.067797
rural community0.066667
infant0.062992
captive0.058824
tonsil0.054422
air0.050955
river0.050314
united kingdom0.046784
rhizosphere0.045028
age 12-19 weeks0.042553
toronto zoo0.042553
cecal content0.042553
size < 10um0.042553
hunter gatherer0.042553
age < 1 year0.042105
age 6 weeks0.041667
dust0.041667
french republic0.041237
LOWER IN city0.041237
ileum0.040404
australia0.039474
city0.039216
rumen0.039216
control0.036496
child0.035398
israel0.034483
research facility0.033058
female0.031496
soil0.030888
poland0.029197
alouatta palliata0.028986
mantled howler monkey0.028986
sciurus carolinensis0.028777
eastern gray squirrel0.028777
jinhua city prefecture0.028777
jinhua pig0.028777
external ear0.028777
qinghai province0.028777
anser0.028777
goose0.028777
greylag goose0.028777
gorilla0.028777
ursus arctos0.028777
brown bear0.028777
bangladesh0.028777
external naris0.028777
perianal skin0.028777
camel0.028777
camelus dromedarius0.028777
clear day0.028777
syncerus caffer caffer0.028777
cape buffalo0.028777
african lion safari0.028777
jiulong river0.028777
fujian province0.028777
nouabale-ndoki national park0.028777
republic of congo0.028777
baijiu0.028777
hefei city prefecture0.028777
chuquisaca department0.028777
forearm0.028777
days 30-400.028777
ryegrass0.028777
shelled egg0.028571
jejunum0.028369
hospital0.028369
province of quebec0.028369
papio anubis0.028369
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum2.000000
poland1.000000
sus scrofa0.888889
pig0.888889
canada0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
thailand0.666667
alouatta palliata0.666667
mantled howler monkey0.666667
india0.571429
broiler chicken0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
external ear0.500000
urocyon littoralis0.500000
age 12-19 weeks0.500000
qinghai province0.500000
anser0.500000
goose0.500000
greylag goose0.500000
gorilla0.500000
toronto zoo0.500000
ursus arctos0.500000
brown bear0.500000
bangladesh0.500000
external naris0.500000
flagstaff0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus obliqua diet0.500000
LOWER IN eucalyptus viminalis0.500000
LOWER IN eucalyptus viminalis diet0.500000
eucalyptus obliqua0.500000
bihar state0.500000
labial commissure0.500000
free range chicken0.500000
age 4 days0.500000
LOWER IN insomnia0.500000
beagle dog0.500000
waste water0.500000
xinxiang city prefecture0.500000
city of melbourne0.500000
perianal skin0.500000
age 30 days0.500000
dairy0.500000
age 6-10 weeks0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
camel0.500000
camelus dromedarius0.500000
fresh clover diet0.500000
LOWER IN clover hay diet0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
new delhi0.500000
syncerus caffer caffer0.500000
cape buffalo0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
qingpu district0.500000
ammotragus lervia0.500000
barbary sheep0.500000
african lion safari0.500000
LOWER IN viet nam0.500000
age 12 weeks0.500000
LOWER IN age 6-10 weeks0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
alpine meadow0.500000
ruminal fluid0.500000
grass growth diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.429630
united states of america0.222222
china0.207407
farm0.200000
homo sapiens0.177778
sus scrofa0.155556
pig0.155556
wild0.140741
caecum0.118519
gallus gallus0.103704
chicken0.103704
skin0.103704
adult0.103704
kingdom of spain0.081481
zoological garden0.081481
canada0.074074
urocyon littoralis catalinae0.074074
santa catalina island fox0.074074
santa catalina island0.074074
urocyon littoralis0.074074
broiler chicken0.059259
state of michigan0.051852
monkey0.051852
canis lupus familiaris0.051852
costa rica0.044444
dog0.044444
LOWER IN united states of america0.044444
infant0.037037
india0.037037
cebus capucinus0.037037
white-faced capuchin0.037037
captive0.037037
thailand0.037037
free range chicken0.037037
control0.037037
rectum0.037037
rural community0.037037
united kingdom0.029630
tonsil0.029630
research facility0.029630
air0.029630
river0.029630
rhizosphere0.029630
soil0.029630
age 6 weeks0.022222
ileum0.022222
age < 1 year0.022222
city0.022222
age 12-19 weeks0.022222
french republic0.022222
female0.022222
toronto zoo0.022222
australia0.022222
cecal content0.022222
rumen0.022222
israel0.022222
dust0.022222
size < 10um0.022222
child0.022222
hunter gatherer0.022222
LOWER IN city0.022222
duodenum0.014815
jejunum0.014815
hospital0.014815
sciurus carolinensis0.014815
eastern gray squirrel0.014815
jinhua city prefecture0.014815
jinhua pig0.014815
external ear0.014815
state of tennessee0.014815
qinghai province0.014815
anser0.014815
goose0.014815
greylag goose0.014815
gorilla gorilla0.014815
gorilla0.014815
province of quebec0.014815
pregnancy0.014815
axilla0.014815
papio anubis0.014815
olive baboon0.014815
nipple0.014815
ursus arctos0.014815
brown bear0.014815
sweden0.014815
bangladesh0.014815
right colon0.014815
left colon0.014815
age 4 weeks0.014815
external naris0.014815
pair of nares0.014815
woodland area0.014815
wet season0.014815
LOWER IN dry season0.014815
perianal skin0.014815
italy0.014815
colon0.014815
tibet autonomous region0.014815
egypt0.014815
camel0.014815
Exp. ID User ID Description Date Region Flag Sequences
495amnondominant gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 6
406amnondominant feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
391amnondominant feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 12
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
388amnondominant pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 14
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
339amnondominant homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
406amnondominant feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 15
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
407amnondominant costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 16
565amnondominant skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 16
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
387amnonhigh freq. in feces of wild brown bear (dominant ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
256amnondominant sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
495amnondominant gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 19
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 23
150amnondominant canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 24
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
540amnondominant dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 27
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 30
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 38
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 68
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 69
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 92
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 185
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
568amnon high in thailand compared to viet nam in gallus gallus chicken feces broiler chicken 2019-12-08v3No1 / 206
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
561amnon high in grass growth diet summer compared to green stage diet spring in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
625amnoncommon feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
620amnon high in nouabale-ndoki national park wild republic of congo pan troglodytes troglodytes compared to united states of america zoological garden pan troglodytes in chimpanzee feces 2020-05-06v4No1 / 351
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
495amnon high in control compared to typhlitis disease intestinal disease in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 412
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 600
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org