Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
sus scrofa0.342508
pig0.342508
farm0.298063
feces0.237605
caecum0.181818
china0.170227
kingdom of spain0.142857
homo sapiens0.138872
gallus gallus0.125000
chicken0.125000
monkey0.118980
canis lupus familiaris0.118044
state of michigan0.113360
adult0.111888
zoological garden0.105263
dog0.105263
wild0.097561
cebus capucinus0.093897
white-faced capuchin0.093897
free range chicken0.091743
rural community0.090361
skin0.088889
costa rica0.087719
united states of america0.086022
infant0.082305
india0.074766
LOWER IN united states of america0.072948
broiler chicken0.072072
tonsil0.072072
air0.066116
river0.065041
united kingdom0.059259
age 12-19 weeks0.057143
size < 10um0.057143
hunter gatherer0.057143
age < 1 year0.056338
age 6 weeks0.055556
rectum0.055556
dust0.055556
LOWER IN city0.055556
french republic0.054795
ileum0.054054
australia0.052632
city0.051724
israel0.047619
child0.047619
female0.040816
poland0.039216
jinhua city prefecture0.038835
jinhua pig0.038835
qinghai province0.038835
anser0.038835
goose0.038835
greylag goose0.038835
gorilla0.038835
ursus arctos0.038835
brown bear0.038835
bangladesh0.038835
cecal content0.038835
camel0.038835
camelus dromedarius0.038835
clear day0.038835
syncerus caffer caffer0.038835
cape buffalo0.038835
thailand0.038835
jiulong river0.038835
fujian province0.038835
age 5-13 years0.038835
chuquisaca department0.038835
forearm0.038835
shelled egg0.038462
jejunum0.038095
hospital0.038095
gorilla gorilla0.038095
province of quebec0.038095
nipple0.038095
wet season0.038095
LOWER IN dry season0.038095
tibet autonomous region0.038095
jiangxi province0.038095
depth 0.5m0.038095
amerindian0.038095
venezuela0.038095
arm0.038095
left colon0.037383
bolivia0.037383
depth 0-20cm0.037383
state of tennessee0.036697
right colon0.036697
age 4 weeks0.036697
egypt0.036697
control0.036530
pregnancy0.036036
south africa0.036036
biofilm0.036036
woodland area0.035398
sweden0.034783
duodenum0.034188
colon0.033898
rumen0.033058
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.888889
pig0.888889
cebus capucinus0.666667
white-faced capuchin0.666667
poland0.666667
myrmecophaga tridactyla0.500000
giant anteater0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
age 12-19 weeks0.500000
qinghai province0.500000
anser0.500000
goose0.500000
greylag goose0.500000
india0.500000
gorilla0.500000
ursus arctos0.500000
brown bear0.500000
bangladesh0.500000
flagstaff0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus obliqua diet0.500000
LOWER IN eucalyptus viminalis0.500000
LOWER IN eucalyptus viminalis diet0.500000
eucalyptus obliqua0.500000
free range chicken0.500000
age 4 days0.500000
beagle dog0.500000
waste water0.500000
xinxiang city prefecture0.500000
city of melbourne0.500000
age 30 days0.500000
dairy0.500000
age 6-10 weeks0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
camel0.500000
camelus dromedarius0.500000
fresh clover diet0.500000
LOWER IN clover hay diet0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
new delhi0.500000
syncerus caffer caffer0.500000
cape buffalo0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
age 12 weeks0.500000
LOWER IN age 6-10 weeks0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
cloud0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
central america0.500000
alouatta palliata0.500000
mantled howler monkey0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
thailand0.500000
karen0.500000
myanmar0.500000
LOWER IN hmong0.500000
hadza0.500000
hunter gatherer0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
LOWER IN typhlitis0.500000
LOWER IN intestinal disease0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
diceros bicornis0.500000
black rhinoceros0.500000
age 30-500.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.484848
farm0.252525
sus scrofa0.212121
pig0.212121
homo sapiens0.212121
united states of america0.202020
china0.191919
caecum0.151515
adult0.121212
kingdom of spain0.111111
gallus gallus0.090909
chicken0.090909
state of michigan0.070707
monkey0.070707
canis lupus familiaris0.070707
zoological garden0.060606
wild0.060606
skin0.060606
dog0.060606
infant0.050505
costa rica0.050505
cebus capucinus0.050505
white-faced capuchin0.050505
free range chicken0.050505
rural community0.050505
broiler chicken0.040404
united kingdom0.040404
tonsil0.040404
india0.040404
air0.040404
control0.040404
river0.040404
LOWER IN united states of america0.040404
age 6 weeks0.030303
ileum0.030303
age < 1 year0.030303
city0.030303
age 12-19 weeks0.030303
french republic0.030303
female0.030303
australia0.030303
research facility0.030303
rectum0.030303
israel0.030303
dust0.030303
size < 10um0.030303
child0.030303
hunter gatherer0.030303
LOWER IN city0.030303
duodenum0.020202
jejunum0.020202
hospital0.020202
jinhua city prefecture0.020202
jinhua pig0.020202
state of tennessee0.020202
qinghai province0.020202
anser0.020202
goose0.020202
greylag goose0.020202
gorilla gorilla0.020202
gorilla0.020202
canada0.020202
province of quebec0.020202
pregnancy0.020202
nipple0.020202
ursus arctos0.020202
brown bear0.020202
sweden0.020202
bangladesh0.020202
right colon0.020202
left colon0.020202
age 4 weeks0.020202
woodland area0.020202
wet season0.020202
LOWER IN dry season0.020202
colon0.020202
cecal content0.020202
tibet autonomous region0.020202
egypt0.020202
camel0.020202
camelus dromedarius0.020202
rumen0.020202
poland0.020202
shelled egg0.020202
jiangxi province0.020202
clear day0.020202
syncerus caffer caffer0.020202
cape buffalo0.020202
south africa0.020202
thailand0.020202
water0.020202
fresh water0.020202
depth 0.5m0.020202
jiulong river0.020202
fujian province0.020202
amerindian0.020202
venezuela0.020202
age 5-13 years0.020202
bolivia0.020202
chuquisaca department0.020202
Exp. ID User ID Description Date Region Flag Sequences
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 6
406amnonhighfreq feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
256amnonhighfreq sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
391amnonhighfreq feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 14
336amnonhighfreq feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
339amnonhighfreq homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
406amnonhighfreq feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 15
470amnonhighfreq sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
407amnonhighfreq costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
256amnonhighfreq sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (highfreq monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
150amnonhighfreq canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 24
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
540amnonhighfreq dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 27
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 38
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 69
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 12 weeks2019-03-03v4No1 / 214
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
495amnon high in control compared to typhlitis disease intestinal disease in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 412
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 600
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org