Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
feces0.319160
canis lupus familiaris0.247928
china0.207217
dog0.206537
zoological garden0.202144
united states of america0.193148
research facility0.184178
homo sapiens0.150056
captive0.141712
gallus gallus0.122861
infant0.116422
macaca mulatta0.115016
chicken0.110769
monkey0.110626
farm0.110017
rural community0.085079
rhesus macaque0.079734
adult0.078442
ileum0.077670
bos taurus0.072437
italy0.071494
child0.068768
india0.067912
skin0.067664
canada0.063660
french republic0.063128
equus caballus0.061392
horse0.054237
rumen0.052689
kingdom of denmark0.051780
female0.049628
colon0.049601
ceratotherium simum0.048499
white rhinoceros0.048499
cobb broiler chicken0.048110
caecum0.047818
female organism0.047425
australia0.047291
cow0.047257
age 35 days0.046980
pig0.045902
ovis aries0.045902
city of melbourne0.042403
foxhound0.041522
new zealand0.041522
lund0.041522
clayey till0.041522
late weichselian glaciation0.041522
duodenum0.041351
loam soil0.040678
broiler chicken0.040268
pair of nares0.040268
state of minnesota0.039867
male0.039120
sus scrofa0.038835
bird0.037975
LOWER IN caecum0.036254
papio anubis0.035149
intestinal contents0.035047
cat0.034642
belgium0.034443
agricultural field0.034384
thailand0.034247
felis catus0.034247
nasal cavity0.033860
russia0.033113
sheep0.033113
age0.032976
control0.032462
city0.032223
olive baboon0.028269
state of wyoming0.028070
centrocercus urophasianus0.028070
greater sage-grouse0.028070
anas platyrhynchos0.028070
small village0.028070
kebbi state0.028070
cayo santiago0.028070
puerto rico0.028070
indian rhesus macaque0.028070
12-month-old human stage0.027939
rectal swab0.027875
commonwealth of pennsylvania0.027682
beagle dog0.027682
10-15-years-old human0.027682
gorilla gorilla0.027682
lamb0.027304
nigeria0.026936
age 6 weeks0.026936
rectum0.026756
LOWER IN wild0.026578
south africa0.026230
LOWER IN control0.025974
united kingdom0.024768
intestine0.024465
bulgaria0.021429
fish feed0.021314
madagascar0.021314
osteopilus septentrionalis0.021314
state of louisiana0.021201
Fraction of dbbact annotations with this term covered by the query
TermScore
china10.000000
colon1.333333
mexico1.000000
namibia1.000000
schistosomiasis1.000000
urinary schistosomiasis1.000000
city of melbourne1.000000
los angeles district1.000000
bulgaria1.000000
LOWER IN spring1.000000
LOWER IN lima1.000000
zoological garden0.666667
papio anubis0.666667
olive baboon0.666667
fish feed0.666667
chicago0.666667
madagascar0.666667
osteopilus septentrionalis0.666667
equus asinus africanus0.666667
LOWER IN rhinoceros unicornis0.666667
LOWER IN greater one-horned rhinoceros0.666667
tragelaphus oryx0.666667
eland0.666667
canis lupus familiaris0.615385
intestinal contents0.600000
ceratotherium simum0.600000
white rhinoceros0.600000
india0.571429
dog0.565217
equus caballus0.555556
spinacia oleracea0.500000
przewalski horse0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
equus hemionus0.500000
onager0.500000
cobb broiler chicken0.500000
crop0.500000
state of wyoming0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
pet0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
state of louisiana0.500000
anas platyrhynchos0.500000
omsk0.500000
peking duck0.500000
macaca mulatta0.500000
rhesus macaque0.500000
enzyme supplementation0.500000
exocrine pancreatic insufficiency0.500000
new delhi0.500000
toronto zoo0.500000
lymphoma0.500000
age 6 months0.500000
bangladesh0.500000
small village0.500000
tunapuco0.500000
age 8 months0.500000
age 2 days0.500000
puppy0.500000
kebbi state0.500000
domestic0.500000
el salvador0.500000
active disease0.500000
dog breeding center0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN tylosin phosphate0.500000
lycaon pictus0.500000
african wild dog0.500000
age 0-6 months0.500000
flagstaff0.500000
age 7 months0.500000
LOWER IN cheek pouch0.500000
macaca fascicularis0.500000
cynomolgus macaque0.500000
foxhound0.500000
hydrolized diet0.500000
new zealand0.500000
age 4 months0.500000
fresh0.500000
LOWER IN late timpoint0.500000
LOWER IN food spoilage0.500000
dog food diet0.500000
LOWER IN raw meat diet0.500000
panthera tigris0.500000
tiger0.500000
LOWER IN high wellfare feed0.500000
age 60 weeks0.500000
bihar state0.500000
LOWER IN no dog0.500000
bedroom0.500000
municipality of santiago de cali0.500000
bucaramanga0.500000
barranquilla0.500000
LOWER IN bogota0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.606498
united states of america0.303249
research facility0.223827
homo sapiens0.205776
canis lupus familiaris0.155235
dog0.126354
zoological garden0.119134
china0.104693
adult0.090253
captive0.086643
gallus gallus0.072202
monkey0.068592
farm0.068592
infant0.068592
chicken0.064982
macaca mulatta0.064982
skin0.046931
italy0.046931
rural community0.046931
ileum0.043321
canada0.043321
rhesus macaque0.043321
child0.043321
french republic0.039711
bos taurus0.039711
india0.036101
female0.036101
control0.032491
equus caballus0.032491
male0.028881
australia0.028881
caecum0.028881
kingdom of denmark0.028881
horse0.028881
rumen0.028881
cobb broiler chicken0.025271
age 35 days0.025271
ceratotherium simum0.025271
white rhinoceros0.025271
pig0.025271
colon0.025271
female organism0.025271
cow0.025271
ovis aries0.025271
state of minnesota0.021661
bird0.021661
broiler chicken0.021661
LOWER IN control0.021661
sus scrofa0.021661
city of melbourne0.021661
foxhound0.021661
new zealand0.021661
duodenum0.021661
LOWER IN caecum0.021661
pair of nares0.021661
agricultural field0.021661
lund0.021661
loam soil0.021661
clayey till0.021661
late weichselian glaciation0.021661
papio anubis0.018051
russia0.018051
intestinal contents0.018051
city0.018051
thailand0.018051
felis catus0.018051
cat0.018051
belgium0.018051
sheep0.018051
nasal cavity0.018051
age0.018051
olive baboon0.014440
state of wyoming0.014440
centrocercus urophasianus0.014440
greater sage-grouse0.014440
intestine0.014440
anas platyrhynchos0.014440
small village0.014440
commonwealth of pennsylvania0.014440
rectal swab0.014440
beagle dog0.014440
nigeria0.014440
kebbi state0.014440
10-15-years-old human0.014440
12-month-old human stage0.014440
rectum0.014440
south africa0.014440
united kingdom0.014440
lamb0.014440
age 6 weeks0.014440
cayo santiago0.014440
puerto rico0.014440
indian rhesus macaque0.014440
LOWER IN wild0.014440
gorilla gorilla0.014440
foodon product type0.010830
fish feed0.010830
state of louisiana0.010830
omsk0.010830
peking duck0.010830
Exp. ID User ID Description Date Region Flag Sequences
74amnoncommon united states of america, spinacia oleracea, foodon product type2017-02-27v4No1 / 6
406amnondominant feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 8
406amnondominant feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
406amnondominant feces, zoological garden, french republic, equus hemionus, onager2018-11-21v4No1 / 9
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
558amnondominant united states of america, crop, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 11
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
840amnondominant farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 12
302amnonhigh freq. in feces of Cockatiel pet birds (dominant feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
790amnondominant farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 14
339amnondominant feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 16
352amnondominant feces, homo sapiens, new delhi, india2018-07-30v4No1 / 16
565amnondominant zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 16
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
488amnondominant feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 18
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
276amnondominant feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
573amnondominant feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
15amnondominant feces, acinonyx jubatus, namibia2016-11-08v4No1 / 21
72amnondominant feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 21
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
406amnondominant feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 21
406amnondominant feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 21
69amnondominant feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
648amnondominant feces, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 22
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
61amnondominant united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
713amnondominant feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 23
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
723amnondominant homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 24
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
406amnondominant feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
817amnon high in lung bronchoalveolar lavage compared to saliva oral cavity oral wash cheek pouch in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
666amnoncommon feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 29
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
668amnon high in age 4 months compared to age 5 years in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces research facility mus musculus c57bl/6 australia mouse 2021-11-17v3No1 / 33
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
759amnon high in dog food diet compared to raw meat diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 35
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 40
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus chicken age 30 days united kingdom 2021-01-30v3No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
327amnoncommon nasopharynx, bos taurus, canada, cow2018-04-30v4No1 / 50
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
649amnoncommon research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 55
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
523amnonhigher in houses with dogs ( high in canis lupus familiaris dog compared to no dog in united states of america building air state of illinois chicago bedroom )2019-07-03v4No1 / 59
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
790amnoncommon farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 61
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
384amnoncommon farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 131
551amnon high in fresh clover diet compared to clover hay diet in rumen adult egypt camel camelus dromedarius 2019-08-27v3No1 / 136
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
471amnoncommon digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
384amnon high in hay barn compared to pasture in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, onthophagus ruficapillus2019-04-18v4No1 / 178
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
860amnoncommon research facility, intestine, anas platyrhynchos, intestinal contents, china, duck2022-01-12v3No1 / 190
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in feces south africa syncerus caffer caffer cape buffalo )2017-03-08v4No1 / 194
585amnoncommon stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 194
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
254amnon high in autumn compared to summer winter in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 206
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
702amnoncommon feces, united states of america, equus caballus, state of north carolina, horse2028-04-02v4No1 / 207
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 248
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
561amnon high in summer grass growth diet compared to green stage diet spring in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 256
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
78amnonhigher in older gazelles ( high in age old age compared to young age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 273
558amnon high in summer compared to winter in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 274
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to south africa wild in feces ceratotherium simum white rhinoceros bovidae )2018-11-21v4No1 / 277
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 318
322amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 320
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
111amnoncommon rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 330
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
551amnoncommon rumen, adult, egypt, camel, camelus dromedarius2019-08-27v3No1 / 370
560amnoncommon united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
559amnon high in ceratotherium simum white rhinoceros compared to rhinoceros unicornis greater one-horned rhinoceros in feces united states of america zoological garden captive 2019-11-03v4No1 / 382
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
739amnoncommon research facility, rumen, age 5 years, ruminal fluid, capra hircus, argentina, goat, creole goat2021-01-30v4No1 / 392
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
758amnon high in cheyenne full flavor cigar cheyenne menthol box cigar compared to swisher sweets original cigar swisher sweets sweet cherry cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 452
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
406amnoncommon feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 474
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
518amnoncommon feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 498
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 516
27amnoncommon rumen, bos grunniens, china2016-12-05v4No1 / 532
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 577
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
406amnoncommon feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v4No1 / 661
781amnoncommon feces, kenya, wild, masai mara national park, tragelaphus oryx, eland2021-04-28v4No1 / 666
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
560amnon high in ceratotherium simum white rhinoceros ceratotherium simum simum compared to rhinoceros unicornis greater one-horned rhinoceros in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 677
666amnoncommon feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 683
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
466amnoncommon feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
406amnoncommon feces, zoological garden, french republic, equus hemionus, onager2018-11-21v4No1 / 885
88amnoncommon feces, south africa, syncerus caffer caffer, cape buffalo2017-03-08v4No1 / 891
632amnoncommon united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 914
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
406amnoncommon feces, zoological garden, french republic, hippotragus niger, sable antelope2018-11-21v4No1 / 1075
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
466amnonlower in cow feces left in field for 30-60 days compared to initial feces ( high in early timepoints 0-2 days compared to late timepoints 30-60 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 1329
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth (water) 1m filtered 2.7um )2019-01-07v4No1 / 1418
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
18amnon high in equus caballus compared to equus przewalskii in feces 2016-11-14v4No1 / 1800
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 2266
748amnon high in feces compared to rumen ruminal fluid in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2467

Problems / suggestions? Please email info AT dbbact DOT org