Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.707216
feces0.460118
united states of america0.350304
adult0.345911
infant0.187500
china0.166811
saliva0.146895
child0.134193
skin0.110236
control0.099821
state of california0.084989
obsolete_juvenile stage0.077604
city0.077504
female0.075282
research facility0.072081
india0.063025
foodon product type0.060545
age0.052708
mus musculus0.051366
nasopharynx0.049793
pair of nares0.049180
australia0.047714
ulcerative colitis0.046726
hospital0.046365
kingdom of denmark0.045833
nasal cavity0.045572
mouth0.045314
mouse0.044280
rural community0.042583
air0.042220
cheese food product0.041841
mucus0.041841
italy0.041408
colombia0.038359
diarrhea0.037995
hunter gatherer0.034139
finland0.034101
duodenum0.033870
bolivia0.033755
crohn's disease0.033613
united kingdom0.033613
breast milk0.033473
canis lupus familiaris0.032787
jiangsu province0.032653
LOWER IN control0.030981
kingdom of spain0.029661
belgium0.029515
river0.029486
cultivated environment0.029371
germany0.029335
kingdom of the netherlands0.029228
state of florida0.028669
leaf0.028499
canada0.025974
amerindian0.025696
venezuela0.025696
urban biome0.025532
LOWER IN caecum0.025532
juvenile organism0.025532
africa0.025532
monkey0.024896
intestine0.024819
water0.023383
state of oklahoma0.021482
age 1 year0.021482
building0.021482
age < 3 years0.021482
newt0.021482
age 5-13 years0.021482
state of michigan0.021425
age 130.021368
french republic0.021292
LOWER IN mouth0.021292
age < 1 year0.021254
commonwealth of virginia0.021254
bird0.021030
desert0.021030
brazil0.021030
dentition0.020975
larval stage0.020848
wild0.020492
digestive system0.020336
homosexual0.017266
msm0.017266
metabolic syndrome0.017241
age 2 months0.017241
oral wash0.017241
tanzania0.017241
bronchus0.017241
atlanta0.017241
salamandra salamandra0.017241
stream0.017241
poland0.017241
arm0.017241
clostridium difficile intestinal infectious disease0.017217
caerphilly cheese0.017167
curd0.017167
oral cavity0.017167
rind0.017167
camembert cheese food product0.017167
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
LOWER IN sinusitis1.000000
male1.000000
infant0.888889
ulcerative colitis0.857143
rural community0.857143
india0.833333
colombia0.800000
hunter gatherer0.750000
homosexual0.750000
msm0.750000
small village0.750000
homo sapiens0.748428
finland0.714286
metabolic syndrome0.666667
LOWER IN mouth neoplasm0.666667
LOWER IN cancer0.666667
state of oklahoma0.666667
age 2 months0.666667
diabetes mellitus0.666667
hospital0.666667
age 1 year0.666667
floor0.666667
dust0.666667
oral wash0.666667
tanzania0.666667
building0.666667
amerindian0.666667
venezuela0.666667
tongue0.666667
bronchus0.666667
medellin metropolitan area0.666667
atlanta0.666667
age < 3 years0.666667
graz city district0.666667
state of new york0.666667
age 1 week0.666667
nectar0.666667
jejunum0.666667
salamandra salamandra0.666667
stream0.666667
nigeria0.666667
newt0.666667
heterosexual0.666667
msw0.666667
age 5-13 years0.666667
poland0.666667
LOWER IN nasopharynx0.666667
gay0.666667
rana catesbeiana0.666667
bullfrog0.666667
arm0.666667
saliva0.640000
air0.636364
adult0.632911
obsolete_juvenile stage0.600000
clostridium difficile intestinal infectious disease0.600000
flower0.600000
city0.588235
diarrhea0.571429
state of michigan0.571429
skin0.560000
duodenum0.555556
child0.550000
caerphilly cheese0.500000
curd0.500000
cheese food product0.500000
yogurt food product0.500000
string cheese0.500000
first trimester0.500000
LOWER IN last trimester0.500000
metabolic syndrome x0.500000
LOWER IN resistant starch type 4 diet0.500000
oral cavity0.500000
LOWER IN neoplasm0.500000
nasopharynx0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age >=7 days0.500000
LOWER IN native american0.500000
american0.500000
LOWER IN arapaho0.500000
LOWER IN cheyenne0.500000
rind0.500000
camembert cheese food product0.500000
pisum sativum0.500000
vellore district0.500000
jordan0.500000
type i diabetes mellitus0.500000
urban biome0.500000
train0.500000
boston0.500000
induced sputum0.500000
fiji0.500000
kingdom of denmark0.500000
hypopharynx0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.670306
feces0.467249
united states of america0.336245
adult0.237991
china0.124454
infant0.104803
saliva0.082969
child0.076419
control0.065502
skin0.061135
state of california0.048035
research facility0.048035
female0.043668
city0.041485
obsolete_juvenile stage0.041485
foodon product type0.032751
india0.032751
mus musculus0.030568
age0.028384
nasopharynx0.026201
australia0.026201
mouse0.026201
pair of nares0.026201
mouth0.024017
nasal cavity0.024017
ulcerative colitis0.024017
hospital0.024017
kingdom of denmark0.024017
cheese food product0.021834
italy0.021834
rural community0.021834
mucus0.021834
air0.021834
LOWER IN control0.019651
diarrhea0.019651
colombia0.019651
breast milk0.017467
hunter gatherer0.017467
bolivia0.017467
duodenum0.017467
finland0.017467
canis lupus familiaris0.017467
crohn's disease0.017467
jiangsu province0.017467
united kingdom0.017467
kingdom of the netherlands0.015284
kingdom of spain0.015284
belgium0.015284
germany0.015284
leaf0.015284
cultivated environment0.015284
state of florida0.015284
river0.015284
urban biome0.013100
amerindian0.013100
venezuela0.013100
LOWER IN caecum0.013100
canada0.013100
juvenile organism0.013100
intestine0.013100
monkey0.013100
africa0.013100
water0.013100
state of oklahoma0.010917
age < 1 year0.010917
age 1 year0.010917
building0.010917
state of michigan0.010917
dentition0.010917
age 130.010917
age < 3 years0.010917
french republic0.010917
LOWER IN mouth0.010917
digestive system0.010917
wild0.010917
larval stage0.010917
commonwealth of virginia0.010917
bird0.010917
newt0.010917
desert0.010917
age 5-13 years0.010917
brazil0.010917
soil0.010917
caerphilly cheese0.008734
curd0.008734
metabolic syndrome0.008734
oral cavity0.008734
rind0.008734
camembert cheese food product0.008734
age 2 months0.008734
oral wash0.008734
tanzania0.008734
costa rica0.008734
stomach0.008734
clostridium difficile intestinal infectious disease0.008734
south africa0.008734
sichuan province0.008734
bronchial epithelium0.008734
bronchus0.008734
LOWER IN adult0.008734
Exp. ID User ID Description Date Region Flag Sequences
74amnonhighfreq caerphilly cheese, curd, united states of america, foodon product type, cheese food product2017-02-27v4No1 / 2
348amnonhighfreq italy, yogurt food product, food (fermented)2018-07-16v4No1 / 2
455amnonColonizes gut as well as saliva (other feces, saliva, homo sapiens)2019-11-25v4No1 / 2
74amnonhighfreq string cheese, united states of america, foodon product type, cheese food product2017-02-27v4No1 / 3
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 3
74amnoncommon string cheese, united states of america, foodon product type, cheese food product2017-02-27v4No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens mouth mucosa oral cavity mouth china 2017-10-01v4No1 / 6
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 6
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
74amnonhighfreq rind, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
74amnonhighfreq curd, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
74amnoncommon caerphilly cheese, curd, united states of america, foodon product type, cheese food product2017-02-27v4No1 / 8
74amnoncommon pisum sativum, united states of america, foodon product type2017-02-27v4No1 / 8
332amnoncommon homo sapiens, infant, vellore district, city, age 2 months, india2018-05-14v4No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 9
245amnonhighfreq homo sapiens, breast milk, china2017-11-21v4No1 / 9
332amnonhighfreq homo sapiens, infant, vellore district, city, age 2 months, india2018-05-14v4No1 / 9
391amnoncommon feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 9
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
74amnonhighfreq caerphilly cheese, rind, united states of america, foodon product type, cheese food product2017-02-27v4No1 / 11
133amnonhigh freq. in infants 0-1 years (highfreq homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (highfreq city, urban biome, train, boston)2017-09-07v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (highfreq united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 11
354amnonhighfreq homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
391amnonhighfreq feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
533amnoncommon homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 11
74amnoncommon curd, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (highfreq homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 12
335amnonhigh freq. in mouthwash (highfreq homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnonhighfreq homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
35amnonhighfreq tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
48amnonhighfreq homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (highfreq skin, homo sapiens)2017-02-15v4No1 / 13
199amnonhigh freq. on shower wall tile (highfreq bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
408amnonhighfreq ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
245amnonhighfreq homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (highfreq homo sapiens, saliva)2017-02-15v4No1 / 15
64amnonhighfreq saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
335amnonhighfreq homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
339amnonhighfreq homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
354amnonhighfreq homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
524amnonhighfreq homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
74amnoncommon rind, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 16
319amnonhighfreq homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
348amnonhighfreq homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
32amnonhighfreq homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnonhighfreq homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
87amnonhighfreq homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
199amnonhigh freq. in kitchen sink (highfreq building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (highfreq homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
278amnonhighfreq homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
418amnonhighfreq coral, ocean, acropora hyacinthus, skeleton2018-12-02v4No1 / 17
418amnonhighfreq coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnonhighfreq homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (highfreq homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 18
488amnonhighfreq canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
54amnonhighfreq homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
66amnonhighfreq homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
242amnonhigh freq. in native-americans (highfreq homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
292amnonhighfreq homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnonhighfreq homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (highfreq saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
390amnonhighfreq homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
247amnonhighfreq homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
390amnonhighfreq homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
567amnoncommon pair of nares, anterior naris, homo sapiens, adult, belgium2019-12-05v4No1 / 21
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
455amnonhighfreq homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
74amnoncommon capsicum annuum, united states of america, foodon product type2017-02-27v4No1 / 23
74amnoncommon prosciutto, united states of america, foodon product type2017-02-27v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
173amnonhighfreq homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
74amnoncommon caerphilly cheese, rind, united states of america, foodon product type, cheese food product2017-02-27v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
3amnonhighfreq homo sapiens, tongue, china2016-10-06v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces infant india )2016-12-19v4No1 / 56
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 65
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to sea water water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 78
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
563amnoncommon control, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
563amnoncommon hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 111
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 241
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
420amnonhigh freq. in soil of vegetable in plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 1396
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org