Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
united states of america0.259091
feces0.244503
research facility0.207336
homo sapiens0.187571
digestive system0.164179
china0.162541
costa rica0.161943
mus musculus0.151348
mouse0.148148
butterfly0.145658
foodon product type0.129093
high fat diet0.120172
adult0.116095
skin0.108469
state of california0.072690
whole body0.069565
body proper0.063173
larval stage0.063073
diet0.061847
desert0.058027
female0.054545
food (fermented)0.053571
panama0.052863
israel0.051635
intestine0.050847
soil0.048176
cheese food product0.047904
rind0.047904
infant0.045714
brazil0.044944
canis lupus familiaris0.044494
male0.044313
c57bl/60.043716
swiss webster0.042618
child0.042599
depth (soil) 50cm0.042169
LOWER IN mouse chow0.041874
finland0.041874
rhizosphere0.041195
state of florida0.040668
city0.040627
germany0.039977
wild0.039818
curd0.036364
heliconius erato0.036364
tropical and subtropical moist broadleaf forest biome0.036364
ensete ventricosum0.036364
ethiopian banana0.036364
belgium0.036364
mexico0.036145
rural community0.036036
c57bl/6j0.035503
bird0.035503
control0.035191
ethiopia0.035088
cultivated environment0.035088
sweden0.034884
control diet0.034682
forest ecosystem0.032258
water0.031250
flower0.030644
minqin county0.030488
ant0.030488
state of rhode island0.030488
nanjing county0.030488
chrysanthemum0.030488
chrysanthemum morifolium ramat.0.030488
tree0.030257
ph 90.030030
depth (soil) 20-60cm0.030030
ph 6.90.030030
fish0.029806
united kingdom0.029586
pond0.029369
pair of nares0.029297
rattus norvegicus0.029155
leaf0.029155
colon0.029049
mouse chow0.028736
jackson laboratories0.028736
sand0.028329
state of georgia0.028329
dog0.028195
farm0.028169
balb/c0.027933
rat0.027933
sus scrofa0.027933
pig0.027933
australia0.026631
nectar0.024691
salamandra salamandra0.024691
arm0.024691
venezuela0.024691
amerindian0.024691
cheddar cheese food product0.024540
caerphilly cheese0.024540
camembert cheese food product0.024540
neomycin0.024540
c57bl/6ncrl0.024540
state of wyoming0.024540
Fraction of dbbact annotations with this term covered by the query
TermScore
butterfly0.666667
dust0.666667
floor0.666667
high fat diet0.666667
nectar0.666667
swiss webster0.666667
LOWER IN low fat diet0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
salamandra salamandra0.666667
building0.666667
LOWER IN nasopharynx0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
foodon product type0.600000
flower0.600000
costa rica0.571429
cheese curd0.500000
cheddar cheese food product0.500000
caerphilly cheese0.500000
curd0.500000
cheese food product0.500000
fermented beverage0.500000
curitiba microregion0.500000
fermented milk0.500000
prosciutto0.500000
caligo illioneus0.500000
illioneus giant owl butterfly0.500000
rind0.500000
camembert cheese food product0.500000
ants0.500000
solenopsis0.500000
ceratitis capitata0.500000
annona cherimola0.500000
mediterranean fruit fly0.500000
marpesia merops0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
depth (soil) 50cm0.500000
minqin county0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
teneral adult0.500000
mechanitis polymnia0.500000
orange-spotted tiger clearwing butterfly0.500000
aeria eurimedia0.500000
pierella helvina0.500000
red-washed satyr butterfly0.500000
heliconius cydno0.500000
cydno longwing butterfly0.500000
coffea arabica0.500000
wet processing0.500000
anal canal0.500000
south florida0.500000
shark0.500000
ant0.500000
jackson laboratory0.500000
ldlr -/-0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
chlosyne gaudialis0.500000
LOWER IN pupa0.500000
pseudodebis zimri0.500000
cissia terrestris0.500000
anser0.500000
goose0.500000
greylag goose0.500000
pseudomyrmex viduus0.500000
taygetis laches0.500000
neomycin0.500000
carcharhinus leucas0.500000
bull shark0.500000
geospiza fortis0.500000
finch0.500000
medium ground finch0.500000
state of rhode island0.500000
food (fermented)0.500000
dulcedo polita0.500000
archaeoprepona demophon0.500000
banded king shoemaker butterfly0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
strain 129s0.500000
fermented corn0.500000
days 2-300.500000
LOWER IN fresh corn0.500000
zea mays subsp. mays0.500000
high fat diet + inulin0.500000
anorexia nervosa0.500000
c57bl/6ncrl0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
psiguria triphylla0.500000
arawacus togarna0.500000
LOWER IN age 9 weeks0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.352201
feces0.311321
homo sapiens0.207547
research facility0.201258
china0.154088
mus musculus0.119497
mouse0.113208
digestive system0.103774
adult0.103774
costa rica0.094340
butterfly0.081761
foodon product type0.072327
high fat diet0.066038
skin0.062893
soil0.044025
state of california0.044025
whole body0.037736
female0.037736
larval stage0.034591
body proper0.034591
diet0.034591
desert0.031447
male0.031447
panama0.028302
israel0.028302
food (fermented)0.028302
intestine0.028302
control0.028302
cheese food product0.025157
brazil0.025157
rind0.025157
infant0.025157
c57bl/60.025157
canis lupus familiaris0.025157
child0.025157
rhizosphere0.025157
depth (soil) 50cm0.022013
state of florida0.022013
swiss webster0.022013
wild0.022013
LOWER IN mouse chow0.022013
finland0.022013
germany0.022013
city0.022013
curd0.018868
heliconius erato0.018868
tropical and subtropical moist broadleaf forest biome0.018868
forest ecosystem0.018868
c57bl/6j0.018868
control diet0.018868
bird0.018868
sweden0.018868
ethiopia0.018868
ensete ventricosum0.018868
ethiopian banana0.018868
belgium0.018868
farm0.018868
mexico0.018868
rural community0.018868
water0.018868
cultivated environment0.018868
minqin county0.015723
sand0.015723
ph 90.015723
depth (soil) 20-60cm0.015723
ant0.015723
flower0.015723
mouse chow0.015723
balb/c0.015723
rattus norvegicus0.015723
rat0.015723
state of rhode island0.015723
state of georgia0.015723
jackson laboratories0.015723
LOWER IN control0.015723
fish0.015723
pair of nares0.015723
dog0.015723
sus scrofa0.015723
pig0.015723
united kingdom0.015723
colon0.015723
pond0.015723
australia0.015723
leaf0.015723
tree0.015723
nanjing county0.015723
chrysanthemum0.015723
chrysanthemum morifolium ramat.0.015723
ph 6.90.015723
cheddar cheese food product0.012579
caerphilly cheese0.012579
camembert cheese food product0.012579
nectar0.012579
antibiotic0.012579
sprague dawley0.012579
neomycin0.012579
c57bl/6ncrl0.012579
LOWER IN caecum0.012579
salamandra salamandra0.012579
Exp. ID User ID Description Date Region Flag Sequences
74amnondominant united states of america, cheese curd, foodon product type, cheddar cheese food product2017-02-27v4No1 / 1
74amnondominant united states of america, caerphilly cheese, curd, foodon product type, cheese food product2017-02-27v4No1 / 2
74amnoncommon united states of america, cheese curd, foodon product type, cheddar cheese food product2017-02-27v4No1 / 4
74amnondominant united states of america, curd, foodon product type2017-02-27v4No1 / 5
692amnondominant brazil, fermented beverage, curitiba microregion, fermented milk2028-03-16v4No1 / 5
74amnoncommon united states of america, curd, foodon product type2017-02-27v4No1 / 6
74amnondominant united states of america, prosciutto, foodon product type2017-02-27v4No1 / 6
501amnondominant digestive system, costa rica, butterfly, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 6
74amnondominant united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
74amnondominant united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
184amnondominant digestive system, peru, ants, solenopsis2017-08-15v4No1 / 7
346amnonhigh freq. in fruitfly larva grown on annona (dominant larval stage, body proper, ceratitis capitata, italy, whole body, annona cherimola, mediterranean fruit fly)2018-06-11v4No1 / 7
501amnoncommon digestive system, costa rica, butterfly, marpesia merops2019-03-09v4No1 / 7
74amnondominant united states of america, rind, foodon product type, cheddar cheese food product2017-02-27v4No1 / 8
74amnoncommon united states of america, caerphilly cheese, curd, foodon product type, cheese food product2017-02-27v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 8
792amnondominant desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 8
74amnondominant united states of america, rind, foodon product type2017-02-27v4No1 / 9
118amnonhigh freq. in captive raised teneral adult butterfly (dominant body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, aeria eurimedia2019-03-09v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 10
501amnoncommon digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
74amnondominant united states of america, rind, caerphilly cheese, foodon product type, cheese food product2017-02-27v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
501amnoncommon digestive system, costa rica, butterfly, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
67amnonhigh freq. in wet processing of coffee beans (dominant coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
74amnoncommon united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 12
118amnoncommon in captive reared butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 12
323amnonhigh freq. in shark cloaca (dominant united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 12
413amnondominant feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 12
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v4No1 / 13
501amnondominant nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly2019-03-08v4No1 / 13
501amnoncommon digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 13
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 13
118amnoncommon in wild butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in body proper panama butterfly heliconius erato whole body tropical and subtropical moist broadleaf forest biome forest ecosystem 2017-04-11v4No1 / 14
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 14
408amnon high in larval stage compared to stomach in united states of america costa rica cephalotes ant 2018-11-22v4No1 / 14
501amnondominant digestive system, costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, pseudodebis zimri2019-03-08v4No1 / 14
501amnoncommon digestive system, costa rica, butterfly, cissia terrestris2019-03-08v4No1 / 14
501amnondominant digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 14
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 15
501amnoncommon digestive system, costa rica, butterfly, taygetis laches2019-03-08v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
592amnondominant feces, state of florida, wild, carcharhinus leucas, bull shark2020-02-18v1No1 / 15
74amnoncommon united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 16
118amnonhigh freq. in wild butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 16
408amnoncommon united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 16
440amnondominant feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
692amnoncommon brazil, fermented beverage, curitiba microregion, fermented milk2028-03-16v4No1 / 16
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
74amnoncommon united states of america, rind, foodon product type, cheddar cheese food product2017-02-27v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
387amnon high in winter compared to summer in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, dulcedo polita2019-03-08v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
39amnonhigh freq. in obsese lepr-db mice (dominant feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 18
158amnondominant united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 18
214amnondominant feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 18
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
118amnonhigh freq. in captive reared butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 19
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays whole plant israel corn )2018-03-19v4No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
2amnon high in anorexia nervosa compared to control in feces homo sapiens 2016-10-05v4No1 / 20
457amnondominant feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 20
539amnondominant ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 20
501amnoncommon nectar, costa rica, flower, psiguria triphylla2019-03-08v4No1 / 21
501amnoncommon digestive system, costa rica, butterfly, arawacus togarna2019-03-09v4No1 / 21
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 21
74amnoncommon united states of america, rind, foodon product type2017-02-27v4No1 / 22
74amnoncommon united states of america, prosciutto, foodon product type2017-02-27v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
181amnoncommon digestive system, research facility, belgium, bombus terrestris, bumblebee2017-08-15v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
74amnoncommon united states of america, rind, caerphilly cheese, foodon product type, cheese food product2017-02-27v4No1 / 26
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
267amnoncommon digestive system, research facility, oreochromis niloticus, fish, china2017-12-24v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
622amnon high in ileum compared to caecum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 29
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
407amnoncommon feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
539amnoncommon ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 35
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, biting midge, culicoides helicaniae2020-09-28v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
112amnoncommon research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
638amnoncommon germany, fermented beverage, wine food product, stuttgart2020-08-21v4No1 / 46
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 47
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
413amnon high in high fat diet compared to mouse chow in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 51
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
116amnoncommon research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 58
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 65
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
211amnonCommon in multiple mouse strains feces (common feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 68
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 69
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
539amnon high in ensete ventricosum var. ketishe compared to ensete ventricosum var. maze in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 74
759amnon high in raw meat diet compared to dog food diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 74
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to late timepoint fresh food spoilage in foodon product type china )2018-01-09v4No1 / 83
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
592amnoncommon digestive system, united states of america, commonwealth of pennsylvania, tenebrio molitor, mealworm, pet store2020-02-18v1No1 / 84
494amnon high in diet high fat diet western diet compared to mouse chow in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 85
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
214amnoncommon feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 96
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
201amnoncommon in cactus fly whole body (common desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 101
413amnoncommon feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 101
499amnoncommon digestive system, pond, larval stage, intestine, brazil, remartinia, aeshnidae, dragonfly2019-03-05v4No1 / 104
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth (water) 0cm in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
67amnoncommon in dry processing of coffee beans (common coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
315amnoncommon in frog gut (common digestive system, colon, jiangxi province, hunan province, frog, quasipaa spinosa, giant spiny frog, china)2018-04-10v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
494amnoncommon research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 161
539amnoncommon ethiopia, late timepoint, ensete ventricosum, ethiopian banana, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
457amnoncommon feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 168
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 186
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 203
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
457amnoncommon feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 204
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
558amnon high in summer compared to winter in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 274
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 352
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth (water) 25cm in north america )2017-10-15v4No1 / 359
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 443
283amnoncommon digestive system, research facility, hindgut, kingdom of denmark, pycnoscelus surinamensis, cockroach, burrowing cockroach2018-01-25v4No1 / 448
504amnoncommon water, sea water, nan'ao island, china2019-03-14v4No1 / 452
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
416amnoncommon united states of america, research facility, colon, termite, reticulitermes flaviceps2018-11-30v4No1 / 511
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 628
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
665amnon high in early time points compared to late time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1052
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 1195
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org