Search result for sequence:
TACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.633682
feces0.599752
adult0.431416
united states of america0.256166
control0.202299
china0.179775
rat0.163043
child0.153159
city0.124260
sprague dawley0.113852
research facility0.100251
obsolete_juvenile stage0.096515
infant0.094241
rattus0.092166
rattus norvegicus0.079433
LOWER IN crohn's disease0.069364
kingdom of spain0.067039
jiangsu province0.063830
india0.058309
czech republic0.058027
state of colorado0.055096
age0.054645
caecum0.052562
female0.049020
heterosexual0.047059
msw0.047059
wistar rat0.047059
colombia0.046875
LOWER IN ulcerative colitis0.046784
male0.042254
state of california0.039604
LOWER IN age < 1 year0.035714
state of oklahoma0.035608
LOWER IN rural community0.035503
LOWER IN colitis0.035294
age 3-60.035294
denver0.035294
LOWER IN child0.035294
age 60-790.035294
age 30-500.035294
age 130.035294
rural community0.035088
biopsy0.034985
age < 3 years0.034682
finland0.034384
russia0.034091
juvenile organism0.034091
commonwealth of virginia0.033520
river0.032967
dog0.030928
canis lupus familiaris0.029126
medellin metropolitan area0.023952
age > 1 year0.023952
metabolic syndrome0.023952
LOWER IN gay0.023952
LOWER IN msm0.023952
LOWER IN homosexual0.023952
LOWER IN diarrhea0.023810
commonwealth of pennsylvania0.023810
taipei city0.023810
taiwan0.023810
LOWER IN exocrine pancreatic insufficiency0.023810
nanchang city prefecture0.023810
age 8-120.023810
new delhi0.023810
age >940.023810
glasgow0.023810
oslo0.023810
age 30-400.023810
toronto0.023810
small village0.023810
age 50-60 years0.023810
nanning city prefecture0.023810
papio anubis0.023810
hunter gatherer0.023810
africa0.023810
wastewater treatment plant0.023810
tibetan plateau0.023669
LOWER IN infant0.023669
systemic lupus erythematosus0.023529
kingdom of denmark0.023529
ulcerative colitis0.023392
state of michigan0.023392
switzerland0.023256
south korea0.023256
high bmi0.023256
biopsy site0.023256
small intestine0.023256
autumn0.023256
rectum0.023121
zoological garden0.022989
belgium0.022727
biofilm0.022727
duodenum0.022222
kingdom of norway0.022222
monkey0.022222
united kingdom0.021978
colon0.021978
germany0.021505
water0.019139
Fraction of dbbact annotations with this term covered by the query
TermScore
sprague dawley0.857143
rattus0.833333
rat0.750000
LOWER IN age < 1 year0.750000
medellin metropolitan area0.666667
age > 1 year0.666667
state of oklahoma0.666667
heterosexual0.666667
msw0.666667
metabolic syndrome0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
LOWER IN crohn's disease0.666667
wistar rat0.666667
india0.666667
colombia0.600000
czech republic0.600000
LOWER IN rural community0.600000
rattus norvegicus0.571429
LOWER IN ulcerative colitis0.571429
homo sapiens0.520000
adult0.513514
daycare0.500000
age 1-5 years0.500000
LOWER IN trichuriasis0.500000
LOWER IN schizophrenia0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN age 2 months0.500000
plant diet0.500000
LOWER IN diarrhea0.500000
LOWER IN colitis0.500000
LOWER IN tnbs0.500000
guangzhou city prefecture0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
commonwealth of pennsylvania0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 17-290.500000
taipei city0.500000
taiwan0.500000
denver0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
LOWER IN enzyme supplementation0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
toronto0.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
LOWER IN estonia0.500000
el salvador0.500000
small village0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
low anterior resection0.500000
age 1-3 years0.500000
spondylitis0.500000
spondyloarthritis0.500000
LOWER IN age >940.500000
ochotona0.500000
atherosclerosis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.914634
homo sapiens0.810976
adult0.371951
united states of america0.359756
control0.201220
china0.195122
research facility0.097561
child0.091463
rat0.091463
city0.073171
sprague dawley0.060976
infant0.054878
obsolete_juvenile stage0.054878
rattus0.048780
rattus norvegicus0.042683
jiangsu province0.036585
LOWER IN crohn's disease0.036585
kingdom of spain0.036585
caecum0.030488
female0.030488
age0.030488
state of colorado0.030488
czech republic0.030488
india0.030488
colombia0.024390
state of california0.024390
male0.024390
heterosexual0.024390
msw0.024390
LOWER IN ulcerative colitis0.024390
wistar rat0.024390
LOWER IN age < 1 year0.018293
commonwealth of virginia0.018293
russia0.018293
age < 3 years0.018293
LOWER IN colitis0.018293
state of oklahoma0.018293
age 3-60.018293
denver0.018293
canis lupus familiaris0.018293
dog0.018293
biopsy0.018293
LOWER IN child0.018293
age 60-790.018293
age 30-500.018293
rural community0.018293
age 130.018293
juvenile organism0.018293
finland0.018293
LOWER IN rural community0.018293
river0.018293
medellin metropolitan area0.012195
switzerland0.012195
germany0.012195
age > 1 year0.012195
LOWER IN diarrhea0.012195
south korea0.012195
systemic lupus erythematosus0.012195
ulcerative colitis0.012195
commonwealth of pennsylvania0.012195
state of michigan0.012195
united kingdom0.012195
high bmi0.012195
taipei city0.012195
taiwan0.012195
LOWER IN exocrine pancreatic insufficiency0.012195
metabolic syndrome0.012195
nanchang city prefecture0.012195
biopsy site0.012195
LOWER IN gay0.012195
LOWER IN msm0.012195
LOWER IN homosexual0.012195
age 8-120.012195
belgium0.012195
tibetan plateau0.012195
new delhi0.012195
duodenum0.012195
small intestine0.012195
age >940.012195
glasgow0.012195
kingdom of norway0.012195
oslo0.012195
age 30-400.012195
toronto0.012195
LOWER IN infant0.012195
small village0.012195
rectum0.012195
age 50-60 years0.012195
nanning city prefecture0.012195
monkey0.012195
zoological garden0.012195
papio anubis0.012195
kingdom of denmark0.012195
hunter gatherer0.012195
water0.012195
autumn0.012195
africa0.012195
wastewater treatment plant0.012195
colon0.012195
biofilm0.012195
Exp. ID User ID Description Date Region Flag Sequences
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 3
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
434amnonhighfreq rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 20
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces china research facility )2017-10-25v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to colitis tnbs in rattus norvegicus rat sprague dawley male research facility china feces )2019-01-06v4No1 / 49
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to exocrine pancreatic insufficiency enzyme supplementation in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
349amnoncommon rattus, rat, feces, china, research facility, sprague dawley, male2018-07-29v4No1 / 235
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
419amnoncommon rat, rattus norvegicus, sprague dawley, china, research facility, feces2018-12-02v4No1 / 254
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in systemic lupus erythematosus latetimepoints age 23-33 weeks compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, china, research facility, feces, constipation)2018-12-02v4No1 / 300
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, china, feces2019-01-06v4No1 / 378
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, china, research facility2017-10-25v4No1 / 470
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
279amnon high in caecum colon compared to stomach small intestine in china ochotonidae pikas 2018-01-24v4No1 / 634
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to colitis dnbs induced colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org