Search result for sequence:
TACGTAGGTGACAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTCCGCAGGTGGTTTGATAAGTCTGACGTGAAATACCGGAGCTCAACTCCGGAACTGCGTTGGAGACTGTTGAACTGGAGTATCGGAGAGGAAATTGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
rural community0.331492
macaca mulatta0.192308
zoological garden0.156863
monkey0.153061
feces0.129804
ethiopia0.125000
chuquisaca department0.125000
thailand0.121212
gorilla gorilla0.117647
age 5-13 years0.117647
homo sapiens0.113051
chimpanzee0.111111
bolivia0.111111
child0.105263
pan troglodytes0.105263
LOWER IN city0.096774
venezuela0.088889
amerindian0.088889
myanmar0.086957
karen0.086957
tunapuco0.086957
cayo santiago0.086957
puerto rico0.086957
indian rhesus macaque0.086957
lincoln park zoo0.086957
saint louis0.086957
saint louis zoo0.086957
hunter gatherer0.086957
rhesus macaque0.086957
holstein-friesian bull0.086957
LOWER IN republic of congo0.086957
LOWER IN nouabale-ndoki national park0.086957
adult0.086804
chicago0.083333
india0.081633
small village0.080000
ireland0.080000
rectal swab0.076923
state of tennessee0.076923
LOWER IN duodenum0.075472
peru0.074074
LOWER IN mouth mucosa0.066667
obsolete_juvenile stage0.064516
male0.053333
bos taurus0.052632
captive0.051282
rumen0.048780
himalayas0.045455
gannan tibetan autonomous prefecture0.045455
LOWER IN gangcha region0.045455
shuar population0.045455
ngoantet0.045455
LOWER IN yaounde0.045455
LOWER IN hmong0.045455
LOWER IN china0.045455
age 10-15 years0.045455
chlorocebus aethiops0.045455
grivet monkey0.045455
LOWER IN age 3-60.045455
LOWER IN age 8-120.045455
china0.045455
chlorocebus djamdjamensis0.045455
bale monkey0.045455
new delhi0.045455
LOWER IN forearm0.045455
theropithecus gelada0.045455
forearm0.045455
gorilla gorilla gorilla0.045455
LOWER IN restricted diet0.045455
nepal0.044444
tibet autonomous region0.044444
village0.044444
cameroon0.044444
age < 1 year0.044444
macaque0.044444
LOWER IN state of oklahoma0.044444
65-79 year-old human stage0.044444
LOWER IN arm0.044444
LOWER IN age 1 month0.044444
LOWER IN mouth0.044444
LOWER IN wild0.044444
LOWER IN pan troglodytes troglodytes0.044444
arm0.044444
amsterdam0.043478
fifth decade human stage0.043478
left colon0.043478
LOWER IN heterosexual0.042553
LOWER IN msw0.042553
LOWER IN 6-12 year-old child stage0.042553
right colon0.042553
LOWER IN jejunum0.042553
normal diet0.042553
tibetan plateau0.041667
homosexual0.041667
msm0.041667
kingdom of the netherlands0.041667
egypt0.041667
state of oregon0.041667
small intestine0.041667
wet season0.041667
Fraction of dbbact annotations with this term covered by the query
TermScore
venezuela0.666667
amerindian0.666667
rural community0.545455
himalayas0.500000
gannan tibetan autonomous prefecture0.500000
LOWER IN gangcha region0.500000
shuar population0.500000
myanmar0.500000
karen0.500000
ngoantet0.500000
LOWER IN yaounde0.500000
tunapuco0.500000
macaca mulatta0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
LOWER IN hmong0.500000
LOWER IN china0.500000
lincoln park zoo0.500000
age 10-15 years0.500000
saint louis0.500000
saint louis zoo0.500000
chlorocebus aethiops0.500000
ethiopia0.500000
grivet monkey0.500000
hunter gatherer0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
china0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
rhesus macaque0.500000
new delhi0.500000
LOWER IN forearm0.500000
chuquisaca department0.500000
holstein-friesian bull0.500000
theropithecus gelada0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
LOWER IN restricted diet0.500000
nepal0.333333
tibet autonomous region0.333333
village0.333333
cameroon0.333333
age < 1 year0.333333
chicago0.333333
gorilla gorilla0.333333
macaque0.333333
LOWER IN state of oklahoma0.333333
65-79 year-old human stage0.333333
LOWER IN arm0.333333
age 5-13 years0.333333
LOWER IN age 1 month0.333333
LOWER IN pan troglodytes troglodytes0.333333
arm0.333333
india0.285714
amsterdam0.250000
small village0.250000
chimpanzee0.250000
fifth decade human stage0.250000
bolivia0.250000
left colon0.250000
ireland0.250000
monkey0.214286
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
rectal swab0.200000
pan troglodytes0.200000
state of tennessee0.200000
LOWER IN 6-12 year-old child stage0.200000
right colon0.200000
LOWER IN jejunum0.200000
normal diet0.200000
LOWER IN duodenum0.181818
thailand0.166667
tibetan plateau0.166667
homosexual0.166667
msm0.166667
kingdom of the netherlands0.166667
peru0.166667
egypt0.166667
state of oregon0.166667
small intestine0.166667
wet season0.166667
LOWER IN dry season0.166667
LOWER IN city0.150000
ecuador0.142857
fourth decade human stage0.142857
3-month-old human stage0.142857
zoological garden0.133333
belgium0.125000
adult organism0.125000
low bmi0.111111
LOWER IN mouth mucosa0.111111
obsolete_juvenile stage0.100000
LOWER IN 2-5 year-old child stage0.090909
duodenum0.090909
crohn's disease0.083333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.880952
homo sapiens0.571429
united states of america0.285714
adult0.261905
rural community0.238095
zoological garden0.190476
child0.142857
macaca mulatta0.119048
monkey0.119048
thailand0.095238
LOWER IN united states of america0.095238
LOWER IN city0.071429
pan troglodytes0.071429
chimpanzee0.071429
gorilla gorilla0.071429
ethiopia0.071429
bolivia0.071429
chuquisaca department0.071429
age 5-13 years0.071429
female0.047619
myanmar0.047619
karen0.047619
male0.047619
peru0.047619
small village0.047619
tunapuco0.047619
cayo santiago0.047619
puerto rico0.047619
rectal swab0.047619
indian rhesus macaque0.047619
chicago0.047619
lincoln park zoo0.047619
obsolete_juvenile stage0.047619
state of tennessee0.047619
LOWER IN duodenum0.047619
saint louis0.047619
saint louis zoo0.047619
venezuela0.047619
amerindian0.047619
hunter gatherer0.047619
india0.047619
research facility0.047619
captive0.047619
rhesus macaque0.047619
LOWER IN mouth mucosa0.047619
LOWER IN mouth0.047619
rumen0.047619
bos taurus0.047619
ireland0.047619
holstein-friesian bull0.047619
LOWER IN wild0.047619
LOWER IN republic of congo0.047619
LOWER IN nouabale-ndoki national park0.047619
crohn's disease0.023810
LOWER IN control0.023810
belgium0.023810
low bmi0.023810
LOWER IN high bmi0.023810
nepal0.023810
himalayas0.023810
gannan tibetan autonomous prefecture0.023810
LOWER IN gangcha region0.023810
tibetan plateau0.023810
tibet autonomous region0.023810
ecuador0.023810
village0.023810
shuar population0.023810
homosexual0.023810
msm0.023810
LOWER IN heterosexual0.023810
LOWER IN msw0.023810
kingdom of the netherlands0.023810
amsterdam0.023810
ngoantet0.023810
LOWER IN yaounde0.023810
cameroon0.023810
LOWER IN female0.023810
infant0.023810
age < 1 year0.023810
LOWER IN hmong0.023810
LOWER IN china0.023810
age 10-15 years0.023810
adult organism0.023810
macaque0.023810
africa0.023810
egypt0.023810
chlorocebus aethiops0.023810
grivet monkey0.023810
LOWER IN infant0.023810
LOWER IN under-1-year-old human stage0.023810
LOWER IN state of oklahoma0.023810
65-79 year-old human stage0.023810
fourth decade human stage0.023810
fifth decade human stage0.023810
LOWER IN child0.023810
LOWER IN age 3-60.023810
LOWER IN age 8-120.023810
LOWER IN 2-5 year-old child stage0.023810
LOWER IN 6-12 year-old child stage0.023810
china0.023810
Exp. ID User ID Description Date Region Flag Sequences
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 70
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 123
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
629amnon high in homosexual msm compared to heterosexual msw in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 154
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org