Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.370060
feces0.360520
china0.339332
infant0.270677
adult0.204422
united states of america0.170455
child0.158730
formula fed0.136986
LOWER IN control0.111842
12-month-old human stage0.110599
germany0.103311
female0.086957
research facility0.086580
caecum0.079365
clostridium difficile intestinal infectious disease0.074906
state of california0.067416
2-5 year-old child stage0.065147
diet0.062893
mouse0.061728
age < 3 years0.060606
chicken0.060241
hispanic or latin american0.059701
LOWER IN breast fed0.059701
LOWER IN 1-month-old human stage0.059701
mus musculus0.059524
gallus gallus0.059347
hospital0.057416
male0.055249
1-year-old human stage0.054795
sweden0.054795
city0.054795
age0.051948
italy0.048193
diarrhea0.046512
los angeles district0.046512
clostridium difficile infection0.046154
sigmoid colon0.046154
mus musculoides0.045455
nyulmc0.045455
nod/shiltj (no. 001976, jackson labs)0.045455
systemic lupus erythematosus0.045455
age 7 months0.045455
nanning city prefecture0.045455
sixth decade human stage0.045455
age 3-60.045455
age >940.045455
tenth decade human stage0.045455
cobb broiler chicken0.045455
guangzhou city prefecture0.044944
hispanic0.044444
ninth decade human stage0.044444
age 35 days0.044444
LOWER IN fourth decade human stage0.043956
finland0.043956
breast fed0.043478
crohn's disease0.043478
6-month-old human stage0.042553
french republic0.041237
kingdom of spain0.040816
antibiotic0.040000
kingdom of denmark0.040000
dog0.037383
canis lupus familiaris0.036364
LOWER IN adult0.033445
farm0.033333
control0.032154
adula0.031250
colon0.031008
after hcst0.030769
hematopoietic stem cell transplant0.030769
pulsed antibiotic treatment, macrolide tylosin tartrate0.030769
oslo0.030769
puppy0.030769
stroke0.030769
indonesia0.030769
municipality of yogyakarta0.030769
terminal ileum0.030769
hangzhou city prefecture0.030769
age 6-14 years0.030769
nephrolithiasis0.030769
fifth decade human stage0.030769
snake farm0.030769
new delhi0.030769
LOWER IN small village0.030769
2-year-old human stage0.030303
1-month-old human stage0.030303
snake0.030303
LOWER IN 65-79 year-old human stage0.030303
fourth decade human stage0.030075
age 1 year0.029851
age 8 weeks0.029851
ulcerative colitis0.029851
biopsy0.029851
LOWER IN fifth decade human stage0.029851
rectal swab0.029412
obsolete_juvenile stage0.029412
LOWER IN rural community0.029197
small intestine0.028986
commonwealth of virginia0.028571
3-month-old human stage0.028571
Fraction of dbbact annotations with this term covered by the query
TermScore
china6.000000
diarrhea1.000000
los angeles district1.000000
acute pancreatitis1.000000
pancreatitis1.000000
adula1.000000
irritable bowel syndrome1.000000
cuba1.000000
LOWER IN mexico1.000000
atlanta1.000000
glasgow1.000000
atherosclerosis1.000000
lima1.000000
clostridium difficile infection0.750000
sigmoid colon0.750000
clostridium difficile intestinal infectious disease0.666667
age < 3 years0.666667
colon0.666667
common variable immunodeficiency0.500000
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
bangladesh diet0.500000
schizophrenia0.500000
LOWER IN age 7 months0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
valladolid0.500000
systemic lupus erythematosus0.500000
chronic fatigue syndrome0.500000
new york county0.500000
oslo0.500000
tucson0.500000
formula fed0.500000
hispanic or latin american0.500000
pemba island0.500000
age 7 months0.500000
puppy0.500000
LOWER IN age 2-7 years0.500000
stroke0.500000
indonesia0.500000
municipality of yogyakarta0.500000
before hsct0.500000
graves' disease0.500000
taoyuan city0.500000
LOWER IN breast fed0.500000
LOWER IN mammalian milk beverage0.500000
LOWER IN 1-month-old human stage0.500000
terminal ileum0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
type 1 diabetes mellitus0.500000
age 14-28 days0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
fifth decade human stage0.500000
little physical activity0.500000
LOWER IN cron diet0.500000
cast/eij0.500000
LOWER IN diet induced metabolic disease0.500000
equine grass sickness0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
weight loss0.500000
weight loss diet0.500000
gaz:000521000.500000
snake farm0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
meleagris gallopavo0.500000
wild turkey0.500000
LOWER IN age one week0.500000
mild0.500000
LOWER IN severe0.500000
new delhi0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN age 2 days0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
sigmoid colon brushing0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
cobb broiler chicken0.500000
spondyloarthritis0.500000
spondylitis0.500000
strain 129s0.500000
shantytown0.500000
LOWER IN el salado0.500000
age 8-120.500000
LOWER IN age 0-6 months0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.888889
homo sapiens0.809524
united states of america0.285714
adult0.261905
infant0.222222
china0.174603
LOWER IN control0.142857
research facility0.119048
child0.111111
germany0.103175
formula fed0.079365
female0.071429
12-month-old human stage0.063492
caecum0.055556
mus musculus0.047619
mouse0.047619
state of california0.047619
control0.039683
diet0.039683
clostridium difficile intestinal infectious disease0.039683
LOWER IN adult0.039683
male0.039683
2-5 year-old child stage0.039683
gallus gallus0.039683
chicken0.039683
italy0.031746
hospital0.031746
hispanic or latin american0.031746
1-year-old human stage0.031746
age < 3 years0.031746
LOWER IN breast fed0.031746
sweden0.031746
LOWER IN 1-month-old human stage0.031746
age0.031746
city0.031746
clostridium difficile infection0.023810
canis lupus familiaris0.023810
dog0.023810
mus musculoides0.023810
nyulmc0.023810
nod/shiltj (no. 001976, jackson labs)0.023810
breast fed0.023810
antibiotic0.023810
diarrhea0.023810
kingdom of spain0.023810
systemic lupus erythematosus0.023810
LOWER IN fourth decade human stage0.023810
los angeles district0.023810
hispanic0.023810
6-month-old human stage0.023810
finland0.023810
age 7 months0.023810
french republic0.023810
guangzhou city prefecture0.023810
crohn's disease0.023810
sigmoid colon0.023810
kingdom of denmark0.023810
nanning city prefecture0.023810
sixth decade human stage0.023810
farm0.023810
age 3-60.023810
age >940.023810
ninth decade human stage0.023810
tenth decade human stage0.023810
cobb broiler chicken0.023810
age 35 days0.023810
LOWER IN antibiotic0.015873
after hcst0.015873
hematopoietic stem cell transplant0.015873
pulsed antibiotic treatment, macrolide tylosin tartrate0.015873
commonwealth of virginia0.015873
age 1 year0.015873
kingdom of norway0.015873
oslo0.015873
2-year-old human stage0.015873
australia0.015873
age 8 weeks0.015873
puppy0.015873
rectal swab0.015873
LOWER IN male0.015873
stroke0.015873
indonesia0.015873
municipality of yogyakarta0.015873
ulcerative colitis0.015873
3-month-old human stage0.015873
terminal ileum0.015873
biopsy0.015873
hangzhou city prefecture0.015873
age 6-14 years0.015873
nephrolithiasis0.015873
fourth decade human stage0.015873
fifth decade human stage0.015873
1-month-old human stage0.015873
united kingdom0.015873
saliva0.015873
rattus norvegicus0.015873
rat0.015873
hunan province0.015873
adula0.015873
snake0.015873
Exp. ID User ID Description Date Region Flag Sequences
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in diet bangladesh diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
127amnoncommon united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 51
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in feces united states of america mus musculus mouse )2017-04-14v4No1 / 63
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 69
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org