Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
feces0.397605
homo sapiens0.389246
infant0.313922
adult0.215934
child0.179245
united states of america0.161445
12-month-old human stage0.121771
china0.116443
germany0.106734
female0.105000
LOWER IN control0.104615
dog0.095745
canis lupus familiaris0.092784
formula fed0.089385
sweden0.084359
2-5 year-old child stage0.084000
crohn's disease0.082840
state of california0.079295
research facility0.075630
clostridium difficile intestinal infectious disease0.073171
italy0.070234
LOWER IN adult0.067416
age < 3 years0.061538
guangzhou city prefecture0.061224
systemic lupus erythematosus0.060606
LOWER IN male0.056818
control0.055046
caecum0.050314
fifth decade human stage0.049080
oncorhynchus mykiss0.049080
rainbow trout0.049080
1-year-old human stage0.048290
fourth decade human stage0.047904
ulcerative colitis0.047904
hospital0.047525
monkey0.047525
kingdom of spain0.045714
city0.044362
age0.043716
fish0.043716
digestive system0.037915
clostridium difficile infection0.037736
sigmoid colon0.037618
breast fed0.037267
oslo0.037267
age 7 months0.037267
terminal ileum0.037267
indonesia0.037267
municipality of yogyakarta0.037267
LOWER IN 1-month-old human stage0.037267
defatted larvae insect diet0.037267
nanning city prefecture0.037267
sixth decade human stage0.037267
age 3-60.037267
africa0.037267
LOWER IN rural community0.037267
LOWER IN fourth decade human stage0.036923
india0.036810
state of minnesota0.036254
finland0.036254
biopsy0.036254
diarrhea0.035928
age 1 year0.035928
obsolete_juvenile stage0.035294
LOWER IN duodenum0.035294
french republic0.034985
kingdom of norway0.033520
kingdom of denmark0.033520
farm0.031414
central african republic0.025316
LOWER IN canis lupus0.025316
LOWER IN wolf0.025316
LOWER IN age 7 months0.025157
age<17 years0.025157
immature stage0.025157
before hsct0.025157
puppy0.025157
meleagris gallopavo0.025157
wild turkey0.025157
hangzhou city prefecture0.025157
age 6-14 years0.025157
nephrolithiasis0.025157
rhesus macaque0.025157
LOWER IN gay0.025157
age >940.025157
tenth decade human stage0.025157
LOWER IN 2-year-old human stage0.025000
heterosexual0.025000
msw0.025000
LOWER IN homosexual0.025000
LOWER IN msm0.025000
atlanta0.024845
adolescent stage0.024845
2-year-old human stage0.024845
LOWER IN 3-month-old human stage0.024845
LOWER IN breast fed0.024845
dry season0.024845
LOWER IN wet season0.024845
age 1 month0.024845
state of oklahoma0.024845
Fraction of dbbact annotations with this term covered by the query
TermScore
clostridium difficile infection0.750000
clostridium difficile intestinal infectious disease0.666667
age < 3 years0.666667
sigmoid colon0.666667
central african republic0.666667
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
guangzhou city prefecture0.600000
2-5 year-old child stage0.600000
common variable immunodeficiency0.500000
irritable bowel syndrome0.500000
systemic lupus erythematosus0.500000
fifth decade human stage0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
valladolid0.500000
chronic fatigue syndrome0.500000
new york county0.500000
oslo0.500000
tucson0.500000
crohn's disease0.500000
age<17 years0.500000
immature stage0.500000
before hsct0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
pemba island0.500000
age 7 months0.500000
juvenile0.500000
inflammatory bowel disease0.500000
terminal ileum0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age 0-6 months0.500000
puppy0.500000
LOWER IN age 2-7 years0.500000
meleagris gallopavo0.500000
wild turkey0.500000
endospore enriched fraction0.500000
lysis0.500000
LOWER IN mammalian milk beverage0.500000
LOWER IN age 2 months0.500000
LOWER IN 1-month-old human stage0.500000
children0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
type 1 diabetes mellitus0.500000
defatted larvae insect diet0.500000
LOWER IN larvae insect diet0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
acute pancreatitis0.500000
pancreatitis0.500000
LOWER IN pre pupae insect diet0.500000
przewalski horse0.500000
stroke0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
lymphoma0.500000
LOWER IN fishmeal diet0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
rhesus macaque0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
LOWER IN vaccination0.500000
LOWER IN salmune vaccination0.500000
equine grass sickness0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN 6-12 year-old child stage0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
africa0.500000
age 2-5 years0.500000
LOWER IN gay0.500000
denver0.500000
LOWER IN age one week0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
dog breeding center0.500000
upano valley0.500000
LOWER IN cross-cutucu0.500000
shuar population0.500000
LOWER IN age 2 days0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
england0.500000
LOWER IN wildlife sactuary0.500000
dnbs induced colitis0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
glasgow0.500000
spondyloarthritis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.883871
homo sapiens0.787097
adult0.258065
united states of america0.251613
infant0.238710
china0.167742
child0.122581
LOWER IN control0.109677
female0.096774
research facility0.096774
germany0.090323
12-month-old human stage0.070968
canis lupus familiaris0.058065
dog0.058065
state of california0.058065
control0.058065
sweden0.051613
formula fed0.051613
crohn's disease0.045161
italy0.045161
2-5 year-old child stage0.045161
clostridium difficile intestinal infectious disease0.038710
LOWER IN adult0.038710
systemic lupus erythematosus0.032258
guangzhou city prefecture0.032258
age < 3 years0.032258
caecum0.032258
LOWER IN male0.032258
kingdom of spain0.025806
age0.025806
fourth decade human stage0.025806
fifth decade human stage0.025806
hospital0.025806
ulcerative colitis0.025806
1-year-old human stage0.025806
monkey0.025806
digestive system0.025806
oncorhynchus mykiss0.025806
fish0.025806
rainbow trout0.025806
city0.025806
clostridium difficile infection0.019355
state of minnesota0.019355
breast fed0.019355
diarrhea0.019355
age 1 year0.019355
LOWER IN fourth decade human stage0.019355
kingdom of norway0.019355
oslo0.019355
obsolete_juvenile stage0.019355
finland0.019355
age 7 months0.019355
sigmoid colon0.019355
terminal ileum0.019355
biopsy0.019355
indonesia0.019355
municipality of yogyakarta0.019355
french republic0.019355
india0.019355
LOWER IN 1-month-old human stage0.019355
kingdom of denmark0.019355
defatted larvae insect diet0.019355
nanning city prefecture0.019355
sixth decade human stage0.019355
farm0.019355
age 3-60.019355
LOWER IN duodenum0.019355
africa0.019355
LOWER IN rural community0.019355
czech republic0.012903
under-1-year-old human stage0.012903
LOWER IN 2-year-old human stage0.012903
LOWER IN age 7 months0.012903
commonwealth of virginia0.012903
age 2 months0.012903
atlanta0.012903
age<17 years0.012903
immature stage0.012903
adolescent stage0.012903
before hsct0.012903
2-year-old human stage0.012903
russia0.012903
australia0.012903
age 8 weeks0.012903
puppy0.012903
rectal swab0.012903
state of ohio0.012903
meleagris gallopavo0.012903
wild turkey0.012903
LOWER IN 3-month-old human stage0.012903
LOWER IN breast fed0.012903
dry season0.012903
LOWER IN wet season0.012903
wild0.012903
3-month-old human stage0.012903
rectum0.012903
colon0.012903
hangzhou city prefecture0.012903
age 6-14 years0.012903
nephrolithiasis0.012903
Exp. ID User ID Description Date Region Flag Sequences
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
838amnondominant united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 27
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
392amnon high in defatted larvae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 49
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
392amnon high in defatted larvae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
663amnon high in switzerland compared to poland in feces homo sapiens adult 2020-09-22v4No1 / 76
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org