Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
soil0.553843
china0.328203
rhizosphere0.252542
united states of america0.184902
agricultural field0.143561
cultivated environment0.130435
leaf0.116362
triticum aestivum0.101757
skin0.099014
depth (soil) 0-20cm0.092154
greenhouse0.086831
depth (soil) 0-10cm0.082350
silt loam0.082162
zea mays0.080508
pot expreiment0.078603
brazil0.078258
river0.077443
kalamazoo loam0.076596
mesic type hapludalf0.076596
kellogg biological station0.076596
germany0.074975
plant0.074689
state of michigan0.073147
topsoil0.069144
fresh water0.066390
wheat0.066079
research facility0.063037
farm0.062257
bulk soil0.061728
austria0.058608
citrus0.057332
loess plateau0.057332
homo sapiens0.055143
ph 7.60.053097
shaanxi province0.052402
root0.052206
feces0.051278
mexico0.050420
desert0.049793
mississippi river0.049034
orchard0.048835
glycine max0.048538
forest ecosystem0.047956
water0.046467
ph 60.044543
ph 70.044379
nanjing county0.044053
chrysanthemum0.044053
chrysanthemum morifolium ramat.0.044053
southern united states0.044053
lettuce0.044053
united states0.044053
des moines0.044053
nicollet soil series0.044053
ph 7-80.044053
agricultural feature0.044053
woodland area0.043732
ph 6.90.043103
snake0.043103
iowa0.043103
state of new york0.042796
state of tennessee0.041322
ultisol0.039823
alabama0.039823
restored prairie0.039823
auburn0.039046
adult0.036745
paddy field soil0.035874
biochar0.035810
minas gerais state0.035556
campos rupestres0.035556
dekalb county0.035556
illinois0.035556
frog0.035139
zhejiang province0.034632
kingdom of denmark0.034335
summer0.034101
state of illinois0.033755
sediment0.032787
depth (soil) 20-60cm0.031496
depth (soil) 10-25cm0.031496
depth (soil) 0-15cm0.031496
depth (soil) 50cm0.031250
agave0.031250
thyrow0.031250
maize field0.031250
populus0.031250
oryza sativa0.031088
sand0.030534
tree0.029851
state of florida0.029851
rat0.029703
intestine0.029412
greenhouse soil0.027149
hordeum vulgare0.027088
particles0.027088
forested area0.027088
clay loam0.027088
compost biofilter0.026906
pig manure0.026906
Fraction of dbbact annotations with this term covered by the query
TermScore
agricultural field0.857143
greenhouse0.750000
wheat0.750000
pot expreiment0.750000
mississippi river0.750000
cultivated environment0.750000
greenhouse soil0.750000
bulk soil0.714286
depth (soil) 0-10cm0.692308
depth (soil) 20-60cm0.666667
dendropsophus minutus0.666667
ph 7.60.666667
stream0.666667
toad0.666667
brassica napus0.666667
venezuela0.666667
amerindian0.666667
hordeum vulgare0.666667
particles0.666667
plant litter0.666667
shandong province0.666667
ph 60.666667
LOWER IN stem0.666667
fen0.666667
heavy metal0.666667
depth (soil) 10-25cm0.666667
LOWER IN depth (soil) 25-50cm0.666667
orchard0.666667
citrus0.666667
depth (soil) 0-15cm0.666667
forested area0.666667
ph 7.70.666667
depth (soil) 15-30cm0.666667
park0.666667
silt loam0.666667
ph 5.60.666667
paddy field soil0.666667
nicotiana tabacum0.666667
soybean0.666667
depth 10-20cm0.666667
loess plateau0.666667
clay loam0.666667
LOWER IN plant litter0.666667
ph 7.850.666667
unamended soil0.666667
soil0.655914
triticum aestivum0.636364
biochar0.625000
rhizosphere0.613636
ph 70.600000
ph 50.600000
rock0.600000
depth 5cm0.600000
river0.583333
glycine max0.571429
topsoil0.555556
beaucarnea recurvata0.500000
dracaena fragrans0.500000
epipremnum aureum0.500000
wine food product0.500000
chronic gastritis0.500000
ants0.500000
azteca0.500000
compost biofilter0.500000
pig manure0.500000
compost soil0.500000
paenibacillus0.500000
nanjing county0.500000
chrysanthemum0.500000
conventional tillage0.500000
chrysanthemum morifolium ramat.0.500000
paenibacillus polymyxa0.500000
soil fumigation0.500000
dazomet0.500000
deep plough0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
depth (soil) 50cm0.500000
minqin county0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
sulfasalazine0.500000
state of rhode island0.500000
fish sauce0.500000
hirundo rustica0.500000
barn swallow0.500000
fusarium0.500000
fusarium oxysporum f. sp. chrysanthemi0.500000
lesser treefrog0.500000
state of ohio0.500000
middle ear fluid0.500000
LOWER IN middle ear rinse0.500000
perth0.500000
recurrent otitis media0.500000
ph 6-6.50.500000
compost0.500000
anser0.500000
goose0.500000
greylag goose0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.479263
china0.329493
united states of america0.244240
rhizosphere0.158986
agricultural field0.078341
cultivated environment0.071429
leaf0.066820
skin0.062212
feces0.057604
triticum aestivum0.055300
homo sapiens0.052995
depth (soil) 0-20cm0.052995
research facility0.050691
greenhouse0.046083
state of michigan0.043779
brazil0.043779
germany0.043779
depth (soil) 0-10cm0.043779
zea mays0.043779
silt loam0.043779
plant0.041475
pot expreiment0.041475
river0.041475
kalamazoo loam0.041475
mesic type hapludalf0.041475
kellogg biological station0.041475
austria0.036866
farm0.036866
topsoil0.036866
fresh water0.036866
wheat0.034562
adult0.032258
bulk soil0.032258
citrus0.029954
loess plateau0.029954
mexico0.027650
desert0.027650
water0.027650
ph 7.60.027650
root0.027650
shaanxi province0.027650
forest ecosystem0.025346
mississippi river0.025346
glycine max0.025346
orchard0.025346
nanjing county0.023041
chrysanthemum0.023041
chrysanthemum morifolium ramat.0.023041
ph 6.90.023041
snake0.023041
southern united states0.023041
ph 70.023041
state of new york0.023041
woodland area0.023041
lettuce0.023041
state of tennessee0.023041
ph 60.023041
iowa0.023041
united states0.023041
des moines0.023041
nicollet soil series0.023041
ph 7-80.023041
agricultural feature0.023041
ultisol0.020737
auburn0.020737
alabama0.020737
restored prairie0.020737
frog0.018433
female0.018433
kingdom of denmark0.018433
control0.018433
summer0.018433
zhejiang province0.018433
minas gerais state0.018433
campos rupestres0.018433
biochar0.018433
sediment0.018433
state of illinois0.018433
dekalb county0.018433
illinois0.018433
paddy field soil0.018433
depth (soil) 50cm0.016129
sand0.016129
depth (soil) 20-60cm0.016129
agave0.016129
rat0.016129
intestine0.016129
thyrow0.016129
maize field0.016129
populus0.016129
tree0.016129
oryza sativa0.016129
depth (soil) 10-25cm0.016129
depth (soil) 0-15cm0.016129
state of florida0.016129
digestive system0.013825
compost biofilter0.013825
pig manure0.013825
paenibacillus0.013825
bio-organic fertilizer0.013825
Exp. ID User ID Description Date Region Flag Sequences
361amnondominant leaf, austria, plant, greenhouse, beaucarnea recurvata2018-08-21v4No1 / 1
361amnondominant leaf, austria, plant, greenhouse, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 1
638amnonsuspected reagent contaminant (higher in NTCs) (contamination)2020-08-18v4No1 / 1
3amnonHigher in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in chronic gastritis compared to in homo sapiens tongue china )2016-10-06v4No1 / 5
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
184amnondominant digestive system, peru, ants, azteca2017-08-15v4No1 / 6
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (dominant soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 7
129amnondominant rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 8
792amnondominant desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 8
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 9
92amnondominant air, japan2017-03-09v4No1 / 10
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (dominant soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (dominant soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 11
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
767sheryoDominant in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (dominant soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 12
492amnondominant skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
605amnon high in middle ear fluid compared to middle ear rinse in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 13
129amnon high in rhizosphere compared to soil in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 14
361amnoncommon leaf, austria, plant, greenhouse, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
361amnoncommon leaf, austria, plant, olea europaea, greenhouse2018-08-21v4No1 / 14
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (dominant soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 14
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
361amnoncommon leaf, austria, plant, greenhouse, nephrolepis cordifolia2018-08-21v4No1 / 18
60amnondominant feces, anser cygnoides, china2017-02-03v4No1 / 19
723amnondominant homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
544amnoncommon united states of america, commonwealth of massachusetts, flower, vaccinium macrocarpon, american cranberry2019-08-04v4No1 / 25
674amnondominant female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 25
536amnoncommon united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
267amnoncommon digestive system, research facility, oreochromis niloticus, fish, china2017-12-24v4No1 / 28
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
361amnoncommon leaf, austria, plant, greenhouse, aloe arborescens, aloe2018-08-21v4No1 / 34
492amnoncommon skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in soil triticum aestivum kingdom of denmark wheat ph 7 agricultural field )2020-04-21v3No1 / 34
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, carphophis amoenus, worm snake2019-07-28v4No1 / 35
361amnoncommon leaf, austria, plant, greenhouse, musa acuminate2018-08-21v4No1 / 37
362amnon high in active vent compared to inactive vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 37
102amnonlower in saliva compared to teeth, cheek ( high in cheek dentition compared to saliva in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 39
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conservation tillage cultivator tillage compared to conventional tillage mouldboard plough in soil triticum aestivum germany ph 7.6 bernburg crop rotation maize pre-crop )2021-04-12v3No1 / 56
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
99amnoncommon united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 74
361amnoncommon leaf, austria, plant, greenhouse, musa paradisiaca2018-08-21v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
361amnoncommon leaf, austria, plant, greenhouse, beaucarnea recurvata2018-08-21v4No1 / 81
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to intestine mucosa digestive tract in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
361amnoncommon leaf, austria, plant, greenhouse, dracaena fragrans2018-08-21v4No1 / 100
536amnoncommon united states of america, skin, snake, crotalus horridus, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
361amnoncommon leaf, austria, plant, greenhouse, malvaviscus penduliflorus2018-08-21v4No1 / 102
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, dendropsophus minutus2019-03-05v4No1 / 102
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
387amnon high in summer compared to winter in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
328amnoncommon feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 116
361amnoncommon leaf, austria, plant, greenhouse, aechmea eurycorymbus2018-08-21v4No1 / 117
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in intestine ictalurus punctatus fish channel catfish compared to pond water fresh water in united states of america research facility state of alabama )2019-02-12v4No1 / 118
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
361amnoncommon leaf, austria, plant, greenhouse, dracaena marginata2018-08-21v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
481amnoncommon united states of america, research facility, intestine, ictalurus punctatus, state of alabama, channel catfish2019-02-12v4No1 / 151
361amnoncommon leaf, austria, plant, greenhouse, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 155
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in soil rhizosphere hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 190
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical and organic fertilizer and had high Fusarium cumulative disease incidence ( high in chemical fertilization n,p,k high fusarium cumulative disease incidence organic fertilizer- chicken manure compost compared to bacterial enriched bio-fertilizer low fusarium cumulative disease incidence fungal enriched bio-fertilizer in wanning city vanilla planifolia ph 7.6 pot expreiment soil from vanilla field fusarium oxysporum f. sp. vanillae )2028-03-08v4No1 / 196
548amnon high in rhizosphere compared to root in brazil minas gerais state campos rupestres vellozia epidendroides 2019-08-15v4No1 / 197
316amnoncommon united states of america, soil, topsoil, state of ohio, ph 5, depth (soil) 0-10cm, forest ecosystem2018-04-10v4No1 / 199
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, upstream, depth (water) 1m, filtered 2.7um, uppper mississippi river2019-01-07v4No1 / 201
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 205
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 210
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years 13-year-old human stage 14-year-old human stage in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
788amnoncommon united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 259
361amnoncommon leaf, austria, plant, greenhouse, chlorophytum comosum2018-08-21v4No1 / 270
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 287
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
156amnoncommon leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 292
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 294
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree cultivated environment root 2019-01-13v4No1 / 300
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 305
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 317
687amnon high in capra hircus goat chinese laoshan milk goat compared to bos taurus chinese bohai black beef cattle chinese luxi yellow beef cattle in research facility rumen rumen liquid shandong province china 2028-03-09v4No1 / 318
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to manured soil manure fertilization organic fertilization bio-dynamic fertilizer in soil bulk soil switzerland pot expreiment lettuce haplic luvisol therwil )2021-04-07v3No1 / 347
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 352
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common soil, rhizosphere, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, lettuce, mineral fertilization)2021-04-08v3No1 / 353
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, lettuce, organic fertilization)2021-04-08v3No1 / 359
512amnon high in baekdudaegan ph 5-6 hani peatland compared to tibetan plateau riganqiao peatland ph 5.5-6.5 in peatland fen soil peat soil china 2019-03-22v4No1 / 363
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in sand epipsammic compared to rock epilithic in river sediment biofilm kingdom of spain )2017-11-22v4No1 / 374
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "south sparkling bog" lake 2028-05-23v4No1 / 382
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
216amnoncommon feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 385
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
800amnoncommon 100-250 days following heavy metal contamination (common lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 412
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
687amnoncommon research facility, rumen, rumen liquid, capra hircus, shandong province, china, goat, chinese laoshan milk goat2028-03-09v4No1 / 429
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 443
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in soil agricultural field ultisol upland soil auburn alabama )2021-08-07v3No1 / 455
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in orchard soil rhizosphere citrus cultivated environment )2018-11-27v4No1 / 458
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in soil zea mays iowa agricultural field united states des moines nicollet soil series kanawha )2021-06-15v4No1 / 501
798amnoncommon orchard, hay, italy, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 508
665amnoncommon united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 526
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
98amnoncommon rhizosphere, state of florida, citrus, immokalee, fl, root2017-04-01v4No1 / 543
98amnoncommon rhizosphere, state of florida, citrus, vero beach, fl, root2017-04-01v4No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
548amnoncommon on leaf surface (common leaf, brazil, minas gerais state, campos rupestres, vellozia epidendroides)2019-08-17v4No1 / 548
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
357amnoncommon soil, mediterranean forest biome, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 564
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, downstream, depth (water) 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 568
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 571
548amnoncommon brazil, minas gerais state, root endosphere, campos rupestres, barbacenia macrantha, root2019-08-17v4No1 / 575
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 500-600m, depth (soil) 0-20cm2020-09-25v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert state of california mexico 2018-08-21v4No1 / 593
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, ph 7.7, nicollet soil series, depth (soil) 15-30cm, kanawha)2021-06-15v4No1 / 598
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
788amnoncommon feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 607
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 609
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, elevation 200-300m, lushan mountain, depth (soil) 0-20cm2020-09-25v4No1 / 613
357amnoncommon savanna, soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 614
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
698amnoncommon park, rhizosphere, united kingdom, london, quercus, ph 4-4.5, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 623
667amnoncommon soil, topsoil, jiangxi province, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.5, depth (soil) 0-20cm2020-09-25v4No1 / 630
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil state of illinois mollisol silt loam dekalb county illinois )2021-08-26v3No1 / 631
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 648
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
548amnoncommon rhizosphere, brazil, minas gerais state, campos rupestres, barbacenia macrantha2019-08-17v4No1 / 651
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 671
357amnoncommon in temperate deciduous forests around the world (common soil, temperate woodland biome, topsoil, depth (soil) 0-10cm, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon park, soil, urban biome, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 685
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 800-900m, depth (soil) 0-20cm2020-09-25v4No1 / 694
103amnon high in downstream compared to upstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 703
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 30-60cm, nicollet soil series, kanawha, ph 8.1)2021-06-15v4No1 / 703
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
758amnon high in swisher sweets original cigar swisher sweets sweet cherry cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 710
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
357amnon high in ph>3 compared to ph<3 in soil subpolar coniferous forest biome topsoil depth (soil) 0-10cm boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon orchard, soil, rhizosphere, reunion island, citrus, cultivated environment2018-11-27v4No1 / 721
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 728
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common soil, depth (soil) 0-10cm, agricultural field, ultisol, upland soil, auburn, alabama)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth (soil) 10-25cm)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 737
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
415amnoncommon orchard, soil, rhizosphere, australia, citrus, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 coarse-loamy soil stover ammendment soil depth (soil) 0-5cm )2020-03-27v4No1 / 747
271amnon high in rhizosphere glycine max soybean compared to soil in china depth (soil) 0-20cm 2018-01-09v4No1 / 750
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 30-50cm)2021-08-08v3No1 / 753
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
667amnoncommon soil, topsoil, jiangxi province, ph 4, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m, depth (soil) 0-20cm2020-09-25v4No1 / 777
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 798
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
548amnoncommon in endopytic roots of Vellozia epidendroides (common brazil, minas gerais state, plant, campos rupestres, vellozia epidendroides, root)2019-08-15v4No1 / 800
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 50-90cm)2021-08-08v3No1 / 815
480amnoncommon farm, pasture, soil, ireland2019-02-05v4No1 / 816
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, topsoil, hokkaido, depth (soil) 0-10cm, ph 5.4, forest ecosystem, japan)2018-08-15v4No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, ph 6, agricultural field, united states, des moines, nicollet soil series, depth (soil) 15-30cm, kelley, subsurface drainage)2021-06-15v4No1 / 841
698amnoncommon park, rhizosphere, disease, ph 5-6, united kingdom, quercus, oak, acute oak decline, plant disease, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 848
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common soil, zea mays, iowa, agricultural field, united states, des moines, depth (soil) 0-15cm, nicollet soil series, ph 7.1, kanawha)2021-06-15v4No1 / 862
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
788amnoncommon united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 897
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, nicollet soil series, depth (soil) 15-30cm, ph 7.4)2021-06-15v4No1 / 905
807amnoncommon surface water, sea water, summer, near shore, filtered 0.2um, tropical storm, japan, okinawa islands2021-06-20v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 27-56cm)2021-08-26v3No1 / 906
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
548amnoncommon rock, brazil, minas gerais state, campos rupestres2019-08-17v4No1 / 924
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
359amnoncommon soil, subtropical broadleaf forest biome, topsoil, guangdong province, depth (soil) 0-10cm, woodland area, forest ecosystem, china2018-08-19v4No1 / 935
462amnoncommon united states of america, state of tennessee, soil, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
98amnoncommon rhizosphere, state of florida, citrus, quincy, fl, root2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v4No1 / 963
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v4No1 / 968
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in soil agricultural field ultisol auburn alabama foot slope )2021-08-08v3No1 / 968
480amnoncommon farm, pasture, soil, new zealand2019-02-05v4No1 / 970
474amnoncommon farm, soil, glycine max, brazil, soybean, ph 4-6, cultivated environment2019-01-16v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1023
103amnon high in downstream compared to upstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 1032
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in soil zea mays glycine max iowa agricultural field united states des moines nicollet soil series kelley subsurface drainage )2021-06-16v4No1 / 1036
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
548amnoncommon rhizosphere, brazil, minas gerais state, campos rupestres, vellozia epidendroides2019-08-15v4No1 / 1040
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 1087
415amnoncommon orchard, soil, rhizosphere, brazil, citrus, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon orchard, soil, rhizosphere, kingdom of spain, citrus, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in soil zea mays glycine max iowa agricultural field united states ames des moines nicollet soil series )2021-06-15v4No1 / 1102
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
698amnoncommon control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 1115
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1136
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
807amnon high in tropical storm compared to normal weather in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 1191
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth (soil) 0-15cm, foot slope )2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, des moines, depth (soil) 0-15cm, nicollet soil series, kelley, ph 6.2, subsurface drainage)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1209
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth (soil) 15-30cm, foot slope )2021-08-08v3No1 / 1218
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 100-300cm)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common soil, zea mays, glycine max, iowa, agricultural field, united states, ames, des moines, ph 7.5, depth (soil) 0-15cm, nicollet soil series)2021-06-15v4No1 / 1226
798amnoncommon orchard, soil, italy, ph 7-8, apennine mountains, prunus armeniaca, apricot, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 1230
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v4No1 / 1241
800amnoncommon 7-18 days following heavy metal contamination (common lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 1248
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
415amnoncommon orchard, soil, rhizosphere, italy, citrus, cultivated environment2018-11-27v4No1 / 1279
788amnon high in soil compared to plant litter in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1280
798amnon high in soil ph 7-8 compared to hay plant litter litter bag in orchard italy apennine mountains prunus armeniaca apricot depth (soil) 0-20cm depth (soil) 10 cm 2021-06-13v3No1 / 1285
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, ph 6, biochar, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1326
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon rhizosphere, state of florida, citrus, ft. pierce, fl, root2017-04-01v4No1 / 1340
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
98amnoncommon rhizosphere, state of florida, citrus, gainesville, fl, root2017-04-01v4No1 / 1371
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-08-02v4No1 / 1387
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, china, depth (soil) 0-20cm2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
548amnoncommon in phosphorus impoverished soil (common soil, brazil, minas gerais state, campos rupestres, ph 3.5)2019-08-15v4No1 / 1483
631sheryoCommon in maize field biochar amended rhizosphere soil (common soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 1492
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 1612
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
462amnon high in silt loam depth (soil) 0-20cm depth (soil) 0-30 cm compared to silt clay loam detph 30-75cm in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v4No1 / 1649
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1704
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
536amnon high in aquatic snake compared to terrestrial snake in united states of america skin snake southern united states 2019-07-28v4No1 / 1772
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>4, ph<5, china, depth (soil) 0-20cm2018-02-11v4No1 / 1886
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth (soil) 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>7, ph<8, china, depth (soil) 0-20cm2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>6, ph<7, china, depth (soil) 0-20cm2018-02-11v4No1 / 2223
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>8, china, depth (soil) 0-20cm2018-02-11v4No1 / 2646
265amnon high in soil compared to water soilwater in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon soil, china, depth (soil) 0-20cm2018-01-09v4No1 / 2856
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20cm, united kingdom2017-03-06v4No1 / 2866
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 20 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 30 years in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in soil triticum aestivum wheat china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 10 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>5, ph<6, china, depth (soil) 0-20cm2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3585
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org