Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
research facility0.265086
skin0.248536
mouse0.224186
mus musculus0.212288
united states of america0.176160
canada0.131343
food (fermented)0.130486
united kingdom0.105109
feces0.098006
farm0.096491
digestive system0.096491
state of rhode island0.095808
oncorhynchus mykiss0.095808
rainbow trout0.095808
fish0.094737
balb/c0.084848
sweden0.083770
city0.079455
intestine0.075269
larval stage0.067797
brazil0.066298
air0.065217
horse0.064171
equus caballus0.062176
barn0.062112
hay0.062112
c57bl/60.060302
sus scrofa0.060241
pig0.060241
LOWER IN feces0.059880
australia0.058537
pair of nares0.056022
israel0.054496
child0.052817
homo sapiens0.052028
control0.051259
salamandra salamandra0.050955
arm0.050955
dermanyssus gallinae0.050314
red poulty mite0.050314
poulty farm0.050314
size < 10um0.050314
foot0.049080
dust0.049080
LOWER IN caecum0.049080
belgium0.048485
body proper0.047904
bird0.047904
gallus gallus0.047904
chicken0.047904
texas0.047904
c57bl/6j0.046784
female0.046296
germany0.045198
leaf0.045028
czech republic0.044693
nasal cavity0.042781
china0.041605
mouth0.041451
japan0.041026
tick0.038585
seed0.038585
liolaemus ruibali0.038217
bank vole0.038217
myodes glareolus0.038217
ukraine0.038217
clear day0.038217
red pepper sauce0.038217
galapagos islands0.038217
finch0.038217
southern united states0.038217
bumble bee0.038217
queen0.038217
hibernation0.038217
caecum0.038217
chuquisaca department0.038217
forearm0.038217
pre pupae insect diet0.038217
argentina0.037500
whole body0.037500
capsicum annuum0.037500
snake0.037500
bombus terrestris0.037500
fishmeal diet0.037500
age 5-13 years0.037500
LOWER IN antibiotic0.037500
oral cavity0.037152
adult0.036874
bolivia0.036810
ileum0.036474
duodenum0.036474
tongue0.036145
midgut0.036145
foodon product type0.036145
antibiotic0.035821
sichuan province0.035503
diet0.034286
rural community0.033708
colon0.033426
stomach0.031088
Fraction of dbbact annotations with this term covered by the query
TermScore
tick0.666667
canada0.666667
salamandra salamandra0.666667
arm0.666667
seed0.666667
venezuela0.666667
amerindian0.666667
food (fermented)0.625000
state of rhode island0.500000
kimchi0.500000
vegan kimchi0.500000
vegan0.500000
LOWER IN non vegan kimchi0.500000
LOWER IN non vegan0.500000
miso food product0.500000
liolaemus ruibali0.500000
mixed0.500000
vancomycin0.500000
balb/c0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
haemaphysalis0.500000
haemaphysalis bancrofti0.500000
size < 10um0.500000
clear day0.500000
barn0.500000
hay0.500000
red pepper sauce0.500000
galapagos islands0.500000
finch0.500000
geospiza scandens0.500000
common cactus finch0.500000
southern united states0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
yellowstone national park0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
eelgrass0.500000
pond0.500000
scinax fuscovarius0.500000
low salt concentration0.500000
LOWER IN high salt concentration0.500000
australian paralysis tick0.500000
ixodes holocyclus0.500000
digestive tract0.500000
LOWER IN campylobacter0.500000
geospiza fortis0.500000
medium ground finch0.500000
douchi0.500000
geospiza fuliginosa0.500000
small ground finch0.500000
bumble bee0.500000
queen0.500000
hibernation0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
external naris0.500000
ixodes scapularis0.500000
LOWER IN pixr immunized0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
LOWER IN defatted larvae insect diet0.500000
LOWER IN larvae insect diet0.500000
age 42 days0.500000
liverpool0.500000
great britain0.500000
LOWER IN malaria0.500000
quail0.500000
coturnix coturnix0.500000
radish0.500000
ixodes ricinus0.500000
castor bean tick0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
termite0.500000
reticulitermes flaviceps0.500000
LOWER IN wood diet0.500000
gut content0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
cold environment0.500000
LOWER IN experimental cerebral malaria0.500000
fire salamander0.500000
red pepper0.500000
fish sauce0.500000
campylobacter0.500000
LOWER IN non hibernating0.500000
nile tilapia0.500000
caecum0.500000
zea mays subsp. mays0.500000
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.350993
united states of america0.331126
feces0.192053
mouse0.192053
mus musculus0.192053
skin0.178808
homo sapiens0.079470
food (fermented)0.072848
canada0.072848
farm0.072848
digestive system0.072848
united kingdom0.059603
fish0.059603
state of rhode island0.052980
control0.052980
oncorhynchus mykiss0.052980
rainbow trout0.052980
sweden0.052980
balb/c0.046358
adult0.046358
china0.046358
intestine0.046358
city0.046358
australia0.039735
c57bl/60.039735
air0.039735
equus caballus0.039735
horse0.039735
brazil0.039735
larval stage0.039735
female0.033113
israel0.033113
pair of nares0.033113
barn0.033113
hay0.033113
LOWER IN feces0.033113
sus scrofa0.033113
pig0.033113
child0.033113
LOWER IN control0.026490
mouth0.026490
dermanyssus gallinae0.026490
red poulty mite0.026490
czech republic0.026490
poulty farm0.026490
foot0.026490
body proper0.026490
dust0.026490
size < 10um0.026490
nasal cavity0.026490
bird0.026490
leaf0.026490
LOWER IN caecum0.026490
gallus gallus0.026490
chicken0.026490
belgium0.026490
salamandra salamandra0.026490
germany0.026490
japan0.026490
texas0.026490
c57bl/6j0.026490
arm0.026490
liolaemus ruibali0.019868
stomach0.019868
argentina0.019868
diet0.019868
antibiotic0.019868
oral cavity0.019868
bank vole0.019868
myodes glareolus0.019868
ukraine0.019868
tongue0.019868
tick0.019868
whole body0.019868
clear day0.019868
red pepper sauce0.019868
capsicum annuum0.019868
sichuan province0.019868
galapagos islands0.019868
finch0.019868
snake0.019868
southern united states0.019868
bombus terrestris0.019868
bumble bee0.019868
midgut0.019868
queen0.019868
hibernation0.019868
fishmeal diet0.019868
ileum0.019868
colon0.019868
foodon product type0.019868
caecum0.019868
age 5-13 years0.019868
bolivia0.019868
rural community0.019868
chuquisaca department0.019868
forearm0.019868
pre pupae insect diet0.019868
LOWER IN antibiotic0.019868
seed0.019868
Exp. ID User ID Description Date Region Flag Sequences
311amnonhigher in vegan compared to non-vegan kimchi ( high in vegan kimchi vegan compared to non vegan kimchi non vegan in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 2
311amnondominant united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 3
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 7
180amnondominant dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 8
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, australia, foot)2017-11-05v4No1 / 8
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
423amnondominant bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 9
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 9
621amnondominant tick, haemaphysalis, haemaphysalis bancrofti, body proper, whole body, australia2020-05-07v1No1 / 9
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
384amnondominant equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 11
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
440amnondominant galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 12
536amnondominant snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 12
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 12
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 13
536amnondominant snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
235amnonhigh freq. in eelgrass leaf (dominant ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
547amnon high in low salt concentration compared to high salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 14
621amnondominant body proper, whole body, australian paralysis tick, ixodes holocyclus, australia2020-05-07v1No1 / 14
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 15
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 15
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
90amnondominant douchi, china, food (fermented)2017-03-08v4No1 / 17
180amnondominant dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
431amnonhigh freq. in midgut of hibernating bumble bees (dominant bombus terrestris, bumble bee, midgut, research facility, queen, belgium, hibernation)2018-12-16v4No1 / 19
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 19
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 20
377amnondominant salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 21
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
622amnon high in ileum compared to caecum in age 42 days research facility liverpool great britain chicken gallus gallus 2020-05-08v4No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
108amnoncommon research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 69
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 127
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
384amnon high in barn hay compared to pasture in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 181
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 183
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 271
384amnoncommon equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 274
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org