Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
research facility0.254121
mouse0.204778
skin0.204545
mus musculus0.195440
united states of america0.156733
whole body0.145299
body proper0.144578
panama0.110672
food (fermented)0.109671
gallus gallus0.100825
chicken0.100825
female0.093677
united kingdom0.085714
digestive system0.084615
feces0.080513
state of rhode island0.080402
oncorhynchus mykiss0.080402
rainbow trout0.080402
fish0.080000
farm0.078782
canada0.073702
balb/c0.071066
LOWER IN caecum0.069022
sweden0.068085
city0.066794
intestine0.062222
sand fly0.061538
mosquito0.061538
china0.061404
larval stage0.056872
israel0.055300
air0.054795
brazil0.054299
horse0.051948
barn0.051813
c57bl/60.051282
equus caballus0.050633
hay0.050505
state of texas0.049875
duodenum0.049669
LOWER IN feces0.049020
australia0.048193
sus scrofa0.047695
pig0.047695
pair of nares0.045872
galapagos islands0.042328
salamandra salamandra0.042328
arm0.042328
control0.042153
dermanyssus gallinae0.041885
red poulty mite0.041885
poulty farm0.041885
size < 10um0.041885
jejunum0.041451
child0.041152
foot0.041026
dust0.041026
sichuan province0.040201
belgium0.040201
oral cavity0.039669
bird0.039409
ileum0.039409
c57bl/6j0.039409
leaf0.038156
homo sapiens0.038069
czech republic0.037915
nasal cavity0.035242
germany0.034934
mouth0.034335
japan0.032922
seed0.032000
liolaemus ruibali0.031746
age 90 weeks0.031746
ukraine0.031746
bank vole0.031746
myodes glareolus0.031746
tick0.031746
clear day0.031746
red pepper sauce0.031746
finch0.031746
southern united states0.031746
bumble bee0.031746
queen0.031746
hibernation0.031746
forearm0.031746
chuquisaca department0.031746
pre pupae insect diet0.031746
capsicum annuum0.031250
snake0.031250
bombus terrestris0.031250
fishmeal diet0.031250
small intestine0.031250
age 5-13 years0.031250
argentina0.030769
bolivia0.030769
LOWER IN antibiotic0.030612
midgut0.030303
foodon product type0.030303
antibiotic0.029412
diet0.028986
Fraction of dbbact annotations with this term covered by the query
TermScore
galapagos islands0.666667
salamandra salamandra0.666667
arm0.666667
seed0.666667
venezuela0.666667
amerindian0.666667
food (fermented)0.625000
vegan kimchi0.500000
vegan0.500000
LOWER IN non vegan kimchi0.500000
LOWER IN non vegan0.500000
state of rhode island0.500000
miso food product0.500000
mixed0.500000
liolaemus ruibali0.500000
uterine tube infundibulum0.500000
age 90 weeks0.500000
balb/c0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
nyssomyia trapidoi0.500000
sand fly0.500000
ukraine0.500000
bank vole0.500000
myodes glareolus0.500000
tick0.500000
haemaphysalis0.500000
haemaphysalis bancrofti0.500000
size < 10um0.500000
clear day0.500000
barn0.500000
red pepper sauce0.500000
geospiza scandens0.500000
finch0.500000
common cactus finch0.500000
southern united states0.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
yellowstone national park0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
eelgrass0.500000
scinax fuscovarius0.500000
low salt concentration0.500000
LOWER IN high salt concentration0.500000
ixodes holocyclus0.500000
australian paralysis tick0.500000
digestive tract0.500000
LOWER IN campylobacter0.500000
culex declarator0.500000
mosquito0.500000
geospiza fortis0.500000
medium ground finch0.500000
douchi0.500000
culex coronator0.500000
coquillettidia0.500000
coquilettidia venezuelensis0.500000
geospiza fuliginosa0.500000
small ground finch0.500000
bumble bee0.500000
queen0.500000
hibernation0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN pixr immunized0.500000
ixodes scapularis0.500000
amblyrhynchus cristatus0.500000
cloacal swab0.500000
marine iguana0.500000
LOWER IN defatted larvae insect diet0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
lutzomyia gomezi0.500000
psychodopygus panamensis0.500000
LOWER IN larvae insect diet0.500000
LOWER IN malaria0.500000
great britain0.500000
age 42 days0.500000
quail0.500000
coturnix coturnix0.500000
radish0.500000
castor bean tick0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
culicoides <genus>0.500000
culicoides batesi0.500000
biting midge0.500000
culicoides foxi0.500000
LOWER IN wood diet0.500000
termite0.500000
reticulitermes flaviceps0.500000
temp 12c0.500000
cold environment0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
gut content0.500000
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.344262
united states of america0.289617
feces0.169399
mus musculus0.163934
mouse0.163934
skin0.147541
female0.109290
body proper0.098361
whole body0.092896
china0.076503
panama0.076503
homo sapiens0.065574
food (fermented)0.060109
gallus gallus0.060109
chicken0.060109
farm0.060109
canada0.060109
digestive system0.060109
united kingdom0.049180
fish0.049180
state of rhode island0.043716
control0.043716
oncorhynchus mykiss0.043716
sweden0.043716
rainbow trout0.043716
balb/c0.038251
adult0.038251
LOWER IN caecum0.038251
intestine0.038251
city0.038251
australia0.032787
sand fly0.032787
c57bl/60.032787
air0.032787
israel0.032787
equus caballus0.032787
horse0.032787
brazil0.032787
mosquito0.032787
larval stage0.032787
hay0.027322
pair of nares0.027322
barn0.027322
state of texas0.027322
LOWER IN feces0.027322
sus scrofa0.027322
pig0.027322
child0.027322
duodenum0.027322
LOWER IN control0.021858
oral cavity0.021858
mouth0.021858
czech republic0.021858
dermanyssus gallinae0.021858
red poulty mite0.021858
poulty farm0.021858
foot0.021858
dust0.021858
size < 10um0.021858
nasal cavity0.021858
sichuan province0.021858
galapagos islands0.021858
bird0.021858
leaf0.021858
belgium0.021858
germany0.021858
salamandra salamandra0.021858
japan0.021858
ileum0.021858
c57bl/6j0.021858
arm0.021858
jejunum0.021858
diet0.016393
stomach0.016393
argentina0.016393
liolaemus ruibali0.016393
antibiotic0.016393
adult organism0.016393
age 90 weeks0.016393
ukraine0.016393
bank vole0.016393
myodes glareolus0.016393
tongue0.016393
tick0.016393
clear day0.016393
capsicum annuum0.016393
red pepper sauce0.016393
finch0.016393
snake0.016393
southern united states0.016393
midgut0.016393
bombus terrestris0.016393
bumble bee0.016393
queen0.016393
hibernation0.016393
wild0.016393
fishmeal diet0.016393
colon0.016393
foodon product type0.016393
small intestine0.016393
Exp. ID User ID Description Date Region Flag Sequences
311amnonhigher in vegan compared to non-vegan kimchi ( high in vegan kimchi vegan compared to non vegan kimchi non vegan in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 2
311amnondominant united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 3
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in research facility stomach argentina liolaemus ruibali )2017-02-25v4No1 / 4
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
795amnoncommon research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 6
179amnondominant united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 7
180amnondominant adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 8
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, foot, australia)2017-11-05v4No1 / 8
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
674amnondominant female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 8
423amnondominant skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 9
456amnondominant tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 9
621amnondominant body proper, australia, whole body, tick, haemaphysalis, haemaphysalis bancrofti2020-05-07v1No1 / 9
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
384amnondominant farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 11
547amnondominant capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 11
440amnondominant feces, geospiza scandens, galapagos islands, bird, finch, common cactus finch2019-01-06v4No1 / 12
536amnondominant united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 12
565amnondominant farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 12
198amnon high in sediment compared to water in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 13
536amnondominant united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 13
235amnonhigh freq. in eelgrass leaf (dominant ocean, leaf, zostera marina, eelgrass)2017-11-07v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
499amnondominant digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 14
547amnon high in low salt concentration compared to high salt concentration in capsicum annuum sichuan province red pepper sauce food (fermented) china 2019-08-15v4No1 / 14
621amnondominant body proper, australia, whole body, ixodes holocyclus, australian paralysis tick2020-05-07v1No1 / 14
328amnondominant research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 15
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 15
456amnoncommon tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
674amnondominant female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 15
440amnondominant feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 16
90amnondominant douchi, food (fermented), china2017-03-08v4No1 / 17
180amnondominant larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
674amnondominant female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 17
674amnondominant female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 17
440amnondominant feces, galapagos islands, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
431amnonhigh freq. in midgut of hibernating bumble bees (dominant research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 19
582amnondominant united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 20
740amnondominant cloaca, ecuador, galapagos islands, alimentary part of gastrointestinal system, amblyrhynchus cristatus, cloacal swab, marine iguana2021-02-08v4No1 / 20
377amnondominant skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in feces research facility mus musculus mouse japan 2019-03-12v4No1 / 21
311amnoncommon united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 22
674amnondominant female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 22
674amnondominant female, body proper, whole body, panama, psychodopygus panamensis, sand fly2020-09-28v4No1 / 22
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
392amnon high in fishmeal diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 23
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
674amnoncommon female, body proper, whole body, panama, coquillettidia, mosquito, coquilettidia venezuelensis2020-09-28v4No1 / 26
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
674amnoncommon female, body proper, whole body, panama, nyssomyia trapidoi, sand fly2020-09-28v4No1 / 27
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 29
622amnon high in ileum compared to caecum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 29
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
674amnoncommon female, body proper, whole body, panama, culex coronator, mosquito2020-09-28v4No1 / 31
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 34
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
180amnoncommon adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
674amnoncommon female, body proper, whole body, panama, culex declarator, mosquito2020-09-28v4No1 / 36
595amnoncommon switzerland, whole body, ixodes ricinus, castor bean tick2020-03-16v4No1 / 42
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
674amnoncommon female, body proper, whole body, culicoides <genus>, panama, culicoides foxi, biting midge2020-09-28v4No1 / 49
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
416amnon high in fasting compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 52
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 58
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 69
91amnoncommon serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 70
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
399amnoncommon feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 89
769sheryoHigh in conventional tillage compared to no tillage in wheat field in northern israel ( high in conventional tillage compared to no tillage in soil bulk soil triticum aestivum israel vertisol northen israel )2021-04-18v4No1 / 91
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
770amnon high in penis male organism compared to vagina female organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 96
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
328amnoncommon research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 109
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
328amnoncommon feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
392amnon high in pre pupae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne full flavor cigar)2021-03-28v3No1 / 128
384amnoncommon farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 131
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 134
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 139
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
214amnon high in strain s129 compared to c57bl/6j in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 148
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
392amnon high in pre pupae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 153
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
192amnoncommon seed structure, brassica napus, seed2017-09-05v4No1 / 161
384amnon high in hay barn compared to pasture in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 181
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
321amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 183
396amnon high in cyprinus carpio common carp compared to oncorhynchus mykiss rainbow trout in digestive system intestine england fish 2018-11-14v4No1 / 184
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
503amnoncommon feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 210
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
167amnoncommon feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 260
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 271
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
758amnon high in cheyenne full flavor cigar cheyenne menthol box cigar compared to swisher sweets original cigar swisher sweets sweet cherry cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 452
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin foot australia )2017-11-05v4No1 / 708
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org