Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
united states of america0.342606
homo sapiens0.286096
skin0.240373
adult0.161266
research facility0.131226
infant0.120073
feces0.112671
costa rica0.099476
female0.085157
ant0.084411
digestive system0.078895
canis lupus familiaris0.077665
pair of nares0.077008
state of california0.068859
larval stage0.066976
water0.066383
nasal cavity0.066176
australia0.062500
whole body0.059395
nasopharynx0.058091
canada0.057837
mucus0.056232
dog0.055345
leaf0.054945
poland0.052001
belgium0.049972
desert0.049724
china0.049594
felis catus0.048531
brazil0.048518
germany0.048371
air0.047716
stomach0.045589
bird0.045589
beetle0.044444
mexico0.044199
city0.043902
river0.043860
fish0.041535
sweden0.041494
wild0.041050
soil0.040449
state of michigan0.038916
child0.038747
age0.038356
nigeria0.038356
sus scrofa0.037634
pig0.037634
cat0.037129
intestine0.037053
1-month-old human stage0.036682
edo state0.036415
LOWER IN feces0.036250
french republic0.036086
mouth0.035684
mus musculus0.035560
farm0.035482
sea water0.035248
fresh water0.035238
urocyon littoralis catalinae0.033708
santa catalina island fox0.033708
urocyon littoralis0.033708
duodenum0.033520
atlantic ocean0.033287
santa catalina island0.033149
ileum0.033058
ocean0.033040
vagina0.030986
coral0.030986
mouse0.030612
united kingdom0.030513
captive0.029683
province of ontario0.029610
epidermis0.029610
saliva0.028862
age 25-45 years0.028450
body proper0.028116
kingdom of denmark0.028050
foodon product type0.028050
breast milk0.027855
switzerland0.027285
state of florida0.026738
control0.025829
lung0.025496
guanajuato0.025496
herbivorous beetle0.025496
centrocercus urophasianus0.025496
greater sage-grouse0.025496
zurich0.025496
state of wyoming0.025175
LOWER IN saliva0.025122
japan0.025070
tonsil0.025017
dentition0.024862
plant0.024862
external acoustic meatus0.022923
frog0.022831
rainbow trout0.022727
oncorhynchus mykiss0.022727
nida basin0.022727
Fraction of dbbact annotations with this term covered by the query
TermScore
mucus0.857143
urine0.800000
gill0.800000
external acoustic meatus0.800000
skin0.769231
inguinal region0.750000
trachea0.750000
ear canal0.750000
2-month-old human stage0.750000
pair of nares0.714286
air0.692308
dense settlement biome0.666667
nipple0.666667
nectar0.666667
conjunctiva0.666667
LOWER IN hindgut0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
bronchus0.666667
uropygial gland0.666667
rana catesbeiana0.666667
bullfrog0.666667
newt0.666667
vitis vinifera0.666667
bangladesh0.666667
cactus0.666667
stream0.666667
dorsum0.666667
bombus terrestris0.666667
crematogaster0.666667
building0.666667
megaptera novaeangliae0.666667
humpback whale0.666667
LOWER IN infant stage0.666667
sinusoidal space0.666667
paranasal sinus0.666667
foot0.666667
state of idaho0.666667
LOWER IN nasopharynx0.666667
portuguese republic0.666667
middle ear0.666667
floor0.666667
gut content0.666667
nasal cavity mucosa0.666667
coelomic fluid0.666667
ant0.666667
porites cylindrica0.666667
galapagos islands0.666667
LOWER IN stem0.666667
tracheal aspirate0.666667
anal swab0.666667
minas gerais state0.666667
skin of cheek0.666667
ph 6.90.666667
chest0.666667
age 25-45 years0.666667
nasal cavity0.642857
1-month-old human stage0.625000
frog0.625000
state of tennessee0.600000
axilla0.600000
hawaii0.600000
sputum0.600000
flower0.600000
nasopharynx0.600000
aquarium0.600000
infant0.588235
LOWER IN mouth0.571429
belgium0.555556
bermuda0.500000
porites astreoides0.500000
sebum0.500000
leaf0.500000
LOWER IN achatinella mustelina0.500000
bolivia0.500000
lung0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
field soil0.500000
LOWER IN 3-month-old human stage0.500000
hypopharynx0.500000
age 1 week0.500000
eriocheir sinensis0.500000
low income0.500000
sewer0.500000
sewage0.500000
LOWER IN effluent0.500000
nicotiana galuca0.500000
contact lens0.500000
skin of face0.500000
skin under eyes0.500000
coffea arabica0.500000
wet processing0.500000
liolaemus ruibali0.500000
LOWER IN plant diet0.500000
rind0.500000
camembert cheese food product0.500000
salami0.500000
curd0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.385174
homo sapiens0.322674
adult0.149709
skin0.142442
feces0.106105
research facility0.097384
infant0.066860
costa rica0.055233
female0.052326
ant0.045058
digestive system0.043605
canis lupus familiaris0.043605
pair of nares0.040698
china0.039244
state of california0.037791
water0.037791
larval stage0.037791
nasal cavity0.034884
australia0.034884
canada0.033430
whole body0.031977
nasopharynx0.030523
dog0.030523
mucus0.029070
leaf0.029070
felis catus0.027616
poland0.027616
soil0.026163
brazil0.026163
germany0.026163
belgium0.026163
desert0.026163
stomach0.024709
air0.024709
bird0.024709
wild0.024709
city0.023256
mexico0.023256
river0.023256
beetle0.023256
cat0.021802
child0.021802
sweden0.021802
fish0.021802
farm0.021802
mus musculus0.020349
age0.020349
state of michigan0.020349
intestine0.020349
sus scrofa0.020349
pig0.020349
nigeria0.020349
sea water0.018895
LOWER IN feces0.018895
mouth0.018895
french republic0.018895
1-month-old human stage0.018895
fresh water0.018895
edo state0.018895
duodenum0.017442
ileum0.017442
control0.017442
mouse0.017442
ocean0.017442
atlantic ocean0.017442
urocyon littoralis catalinae0.017442
santa catalina island fox0.017442
santa catalina island0.017442
urocyon littoralis0.017442
saliva0.015988
vagina0.015988
united kingdom0.015988
coral0.015988
captive0.015988
province of ontario0.015988
epidermis0.015988
breast milk0.014535
kingdom of denmark0.014535
foodon product type0.014535
body proper0.014535
state of florida0.014535
switzerland0.014535
age 25-45 years0.014535
LOWER IN saliva0.013081
lung0.013081
japan0.013081
dentition0.013081
plant0.013081
guanajuato0.013081
tonsil0.013081
herbivorous beetle0.013081
centrocercus urophasianus0.013081
greater sage-grouse0.013081
state of wyoming0.013081
zurich0.013081
LOWER IN caecum0.011628
hospital0.011628
subgingival plaque0.011628
external acoustic meatus0.011628
pacific ocean0.011628
Number of experiments associating the term to the sequence
TermScore
united states of america87.000000
homo sapiens83.000000
feces46.000000
research facility36.000000
adult36.000000
skin30.000000
infant20.000000
female16.000000
water15.000000
china13.000000
digestive system12.000000
LOWER IN feces12.000000
state of california12.000000
sea water11.000000
canis lupus familiaris11.000000
leaf11.000000
mus musculus10.000000
pair of nares10.000000
control10.000000
soil9.000000
city9.000000
nasal cavity9.000000
air9.000000
australia9.000000
mouth8.000000
saliva8.000000
brazil8.000000
germany8.000000
dog8.000000
mouse8.000000
child8.000000
LOWER IN caecum7.000000
age7.000000
vagina7.000000
fish7.000000
duodenum6.000000
ileum6.000000
mucus6.000000
LOWER IN saliva6.000000
french republic6.000000
japan6.000000
dentition6.000000
intestine6.000000
nasopharynx6.000000
fresh water6.000000
body proper6.000000
canada6.000000
sweden6.000000
captive6.000000
stomach5.000000
lung5.000000
1-month-old human stage5.000000
larval stage5.000000
belgium5.000000
river5.000000
ocean5.000000
united kingdom5.000000
bird5.000000
frog5.000000
whole body5.000000
urine4.000000
LOWER IN mouth4.000000
kingdom of denmark4.000000
gill4.000000
state of michigan4.000000
subgingival plaque4.000000
mexico4.000000
external acoustic meatus4.000000
desert4.000000
atlantic ocean4.000000
sus scrofa4.000000
pig4.000000
pacific ocean4.000000
poland4.000000
wild4.000000
costa rica4.000000
farm4.000000
state of tennessee3.000000
inguinal region3.000000
axilla3.000000
hawaii3.000000
sputum3.000000
hospital3.000000
LOWER IN 3-month-old human stage3.000000
age 1 week3.000000
flower3.000000
trachea3.000000
ear canal3.000000
coral3.000000
aquarium3.000000
state of florida3.000000
2-month-old human stage3.000000
felis catus2.000000
bolivia2.000000
dense settlement biome2.000000
breast milk2.000000
nipple2.000000
nectar2.000000
conjunctiva2.000000
LOWER IN hindgut2.000000
foodon product type2.000000
arm2.000000
venezuela2.000000
amerindian2.000000
bronchus2.000000
uropygial gland2.000000
rana catesbeiana2.000000
bullfrog2.000000
newt2.000000
vitis vinifera2.000000
bangladesh2.000000
cactus2.000000
stream2.000000
dorsum2.000000
bombus terrestris2.000000
crematogaster2.000000
building2.000000
megaptera novaeangliae2.000000
humpback whale2.000000
LOWER IN infant stage2.000000
sinusoidal space2.000000
paranasal sinus2.000000
foot2.000000
beetle2.000000
plant2.000000
state of idaho2.000000
LOWER IN nasopharynx2.000000
portuguese republic2.000000
middle ear2.000000
floor2.000000
rainbow trout2.000000
oncorhynchus mykiss2.000000
gut content2.000000
nasal cavity mucosa2.000000
coelomic fluid2.000000
tonsil2.000000
ant2.000000
porites cylindrica2.000000
galapagos islands2.000000
LOWER IN stem2.000000
tracheal aspirate2.000000
anal swab2.000000
minas gerais state2.000000
switzerland2.000000
skin of cheek2.000000
ph 6.92.000000
chest2.000000
nigeria2.000000
age 25-45 years2.000000
bermuda1.000000
porites astreoides1.000000
sebum1.000000
LOWER IN achatinella mustelina1.000000
maryland county1.000000
LOWER IN solanum lycopersicum1.000000
field soil1.000000
hypopharynx1.000000
eriocheir sinensis1.000000
low income1.000000
sewer1.000000
sewage1.000000
LOWER IN effluent1.000000
nicotiana galuca1.000000
contact lens1.000000
skin of face1.000000
skin under eyes1.000000
coffea arabica1.000000
wet processing1.000000
liolaemus ruibali1.000000
LOWER IN plant diet1.000000
rind1.000000
camembert cheese food product1.000000
salami1.000000
curd1.000000
cat1.000000
guanajuato1.000000
nida basin1.000000
herbivorous beetle1.000000
centrocercus urophasianus1.000000
greater sage-grouse1.000000
state of wyoming1.000000
urocyon littoralis catalinae1.000000
santa catalina island fox1.000000
santa catalina island1.000000
urocyon littoralis1.000000
edo state1.000000
zurich1.000000
province of ontario1.000000
epidermis1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
558amnon high in duodenum compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v41 / 1approvedNo
227amnonpeaks at age 1 month in baby nasopharynx ( high in 1-month-old human stage age compared to infant stage newborn human stage in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 2approvedNo
408amnon high in larval stage compared to stomach in ant costa rica united states of america camponotus 2018-11-22v41 / 2approvedNo
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v41 / 2approvedNo
850amnoncommon in vitro fertilization clinic, adult, anambra state, nigeria, female organism, vagina, homo sapiens2021-12-16v41 / 2approvedNo
74amnondominant salami, united states of america, foodon product type2017-02-27v41 / 3approvedNo
184amnoncommon peru, digestive system, ants, pseudomyrmex2017-08-15v41 / 4approvedNo
245amnondominant homo sapiens, breast milk, finland2017-11-21v41 / 4approvedNo
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v41 / 4approvedNo
360amnondominant desert, soil, mexico, guanajuato2018-08-21v41 / 4approvedNo
418amnoncommon coral, ocean, acropora hyacinthus, tissue2018-12-02v41 / 4approvedNo
74amnoncommon salami, united states of america, foodon product type2017-02-27v41 / 5approvedNo
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v41 / 5approvedNo
301amnon high in duodenum ileum compared to colon rectum in canis lupus familiaris dog united states of america 2018-03-05v41 / 5approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v41 / 5approvedNo
408amnoncommon ant, costa rica, united states of america, pheidole, stomach2018-11-22v41 / 5approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v41 / 5approvedNo
968amnondominant skin, homo sapiens, switzerland, adult, zurich, neck2022-12-23v11 / 5approvedNo
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v41 / 6approvedNo
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v41 / 6approvedNo
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v41 / 6approvedNo
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v41 / 6approvedNo
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 6approvedNo
968amnondominant skin, homo sapiens, switzerland, adult, zurich, glabella region2022-12-23v11 / 6approvedNo
52amnoncommon homo sapiens, skin, nipple, state of california2017-01-19v41 / 7approvedNo
74amnondominant curd, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v41 / 7approvedNo
184amnoncommon peru, digestive system, azteca, ants2017-08-15v41 / 7approvedNo
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v41 / 7approvedNo
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v41 / 7approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, larval stage2018-11-22v41 / 7approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v41 / 7approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v41 / 7approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v41 / 7approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v41 / 7approvedNo
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 7approvedNo
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 7approvedNo
960amnoncommon edo state, adult, female, nigeria, vagina, homo sapiens2022-12-20v41 / 7approvedNo
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, australia, foot)2017-11-05v41 / 8approvedNo
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v41 / 8approvedNo
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v41 / 8approvedNo
332amnoncommon 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v41 / 8approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v41 / 8approvedNo
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v41 / 8approvedNo
408amnondominant ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v41 / 8approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v41 / 8approvedNo
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v41 / 8approvedNo
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 8approvedNo
749amnondominant third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v41 / 8approvedNo
960amnoncommon 1-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
960amnoncommon meconium, newborn human stage, infant, feces, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
819amnondominant dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v11 / 8approvedNo
717amnondominant upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 8approvedNo
92amnoncommon air, japan2017-03-09v41 / 9approvedNo
227amnoncommon in baby nasopharynx age 1 day to 3 months (common 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 9approvedNo
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v41 / 9approvedNo
244amnondominant drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v41 / 9approvedNo
245amnondominant homo sapiens, breast milk, china2017-11-21v41 / 9approvedNo
408amnondominant ant, costa rica, united states of america, pheidole, stomach2018-11-22v41 / 9approvedNo
418amnoncommon coral, ocean, echinopora mammiformis, tissue2018-12-02v41 / 9approvedNo
819amnondominant adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v11 / 9approvedNo
819amnondominant skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v11 / 9approvedNo
968amnondominant skin, homo sapiens, switzerland, adult, zurich, top of head2022-12-23v11 / 9approvedNo
26amnondominant canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v41 / 10approvedNo
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v41 / 10approvedNo
227amnoncommon in baby nasopharynx age 6 months to 1 year (common 12-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands)2017-10-30v41 / 10approvedNo
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant 12-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 10approvedNo
354amnondominant homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v41 / 10approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v41 / 10approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v41 / 10approvedNo
523amnondominant air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v41 / 10approvedNo
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 10approvedNo
749amnondominant third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v41 / 10approvedNo
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v41 / 11approvedNo
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, infant, nasopharynx, australia)2017-04-16v41 / 11approvedNo
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v41 / 11approvedNo
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v41 / 11approvedNo
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, state of california, hospital, floor, dust)2018-03-31v41 / 11approvedNo
370amnondominant desert, air, gobi desert2018-09-06v41 / 11approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v41 / 11approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v41 / 11approvedNo
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v41 / 11approvedNo
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v41 / 11approvedNo
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v41 / 11approvedNo
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v41 / 11approvedNo
533amnoncommon 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v41 / 11approvedNo
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v41 / 11approvedNo
567amnoncommon belgium, adult, homo sapiens, nasopharynx2019-12-05v41 / 11approvedNo
664amnoncommon blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v41 / 11approvedNo
879amnondominant adult organism, chest, captive, dog, austria, canis lupus familiaris, skin, research facility2022-03-12v41 / 11approvedNo
819amnondominant dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v11 / 11approvedNo
968amnondominant skin, homo sapiens, switzerland, adult, zurich, elbow, antecubital fossa2022-12-23v11 / 11approvedNo
717amnondominant plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 11approvedNo
26amnondominant united states of america, felis catus, mucus, pair of nares2016-12-05v41 / 12approvedNo
26amnondominant homo sapiens, united states of america, pair of nares, mucus2016-12-05v41 / 12approvedNo
74amnoncommon curd, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v41 / 12approvedNo
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v41 / 12approvedNo
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v41 / 12approvedNo
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 12approvedNo
301amnondominant canis lupus familiaris, dog, united states of america, ileum2018-03-05v41 / 12approvedNo
370amnoncommon desert, air, gobi desert2018-09-06v41 / 12approvedNo
397amnondominant panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v41 / 12approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v41 / 12approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v41 / 12approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v41 / 12approvedNo
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v41 / 12approvedNo
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v41 / 12approvedNo
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v41 / 12approvedNo
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 12approvedNo
766amnoncommon puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v41 / 12approvedNo
684amnondominant middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v11 / 12approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v31 / 12approvedNo
717amnondominant palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 12approvedNo
717amnondominant external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 12approvedNo
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v41 / 13approvedNo
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v41 / 13approvedNo
63amnonhigh freq. in skin in american gut (dominant skin, homo sapiens)2017-02-15v41 / 13approvedNo
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v41 / 13approvedNo
199amnonhigh freq. on shower wall tile (dominant bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v41 / 13approvedNo
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v41 / 13approvedNo
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v41 / 13approvedNo
534amnondominant river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v41 / 13approvedNo
567amnondominant belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v41 / 13approvedNo
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v41 / 13approvedNo
647amnoncommon in skin of columbia spotted frog (common lake, rana luteiventris, columbia spotted frog, frog, skin, united states of america, state of montana)2020-09-06v41 / 13approvedNo
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
968amnoncommon top of head, zurich, adult, switzerland, homo sapiens, skin2022-12-23v11 / 13approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v31 / 13approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v31 / 13approvedNo
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v41 / 14approvedNo
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v41 / 14approvedNo
158amnondominant cat, felis catus, united states of america, conjunctiva2017-07-06v41 / 14approvedNo
158amnondominant united states of america, pair of nares, felis catus, cat2017-07-06v41 / 14approvedNo
209amnonhigh freq. in whale blow condensate (dominant north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v41 / 14approvedNo
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v41 / 14approvedNo
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v41 / 14approvedNo
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v41 / 14approvedNo
245amnondominant homo sapiens, breast milk, south africa2017-11-21v41 / 14approvedNo
277amnondominant homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v41 / 14approvedNo
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v41 / 14approvedNo
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v41 / 14approvedNo
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v41 / 14approvedNo
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v41 / 14approvedNo
418amnoncommon coral, ocean, porites cylindrica, tissue2018-12-02v41 / 14approvedNo
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v41 / 14approvedNo
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v41 / 14approvedNo
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v41 / 14approvedNo
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 14approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, infant, newborn human stage, meconium2022-12-20v41 / 14approvedNo
684amnoncommon middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v11 / 14approvedNo
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v41 / 15approvedNo
58amnondominant homo sapiens, new york city, contact lens2017-02-02v41 / 15approvedNo
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v41 / 15approvedNo
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v41 / 15approvedNo
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v41 / 15approvedNo
245amnoncommon homo sapiens, breast milk, china2017-11-21v41 / 15approvedNo
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant cloud, french republic, air, autumn)2017-11-22v41 / 15approvedNo
291amnondominant canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v41 / 15approvedNo
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v41 / 15approvedNo
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v41 / 15approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v41 / 15approvedNo
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v41 / 15approvedNo
550amnon high in starfish coelomic fluid wild patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v41 / 15approvedNo
960amnondominant homo sapiens, vagina, nigeria, female, adult, edo state2022-12-20v41 / 15approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 1-month-old human stage2022-12-20v41 / 15approvedNo
819amnoncommon dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v11 / 15approvedNo
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, ear, external acoustic meatus2022-12-25v31 / 15approvedNo
74amnoncommon rind, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v41 / 16approvedNo
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v41 / 16approvedNo
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v41 / 16approvedNo
198amnondominant yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v41 / 16approvedNo
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v41 / 16approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 16approvedNo
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v41 / 16approvedNo
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v41 / 16approvedNo
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v41 / 16approvedNo
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v41 / 16approvedNo
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v41 / 16approvedNo
645amnondominant cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v41 / 16approvedNo
663amnondominant pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v41 / 16approvedNo
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v41 / 16approvedNo
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v11 / 16approvedNo
717amnondominant upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 16approvedNo
158amnondominant cat, felis catus, united states of america, axilla2017-07-06v41 / 17approvedNo
184amnoncommon peru, digestive system, myrmelachista, ants2017-08-15v41 / 17approvedNo
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v41 / 17approvedNo
277amnondominant homo sapiens, belgium, adult, nasopharynx2018-01-23v41 / 17approvedNo
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v41 / 17approvedNo
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v41 / 17approvedNo
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v41 / 17approvedNo
418amnondominant coral, ocean, acropora hyacinthus, skeleton2018-12-02v41 / 17approvedNo
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v41 / 17approvedNo
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v41 / 17approvedNo
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v41 / 17approvedNo
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v41 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, female, adult2022-12-20v41 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, 15-month-old human stage, oral cavity2022-12-20v41 / 17approvedNo
158amnondominant cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v41 / 18approvedNo
245amnoncommon homo sapiens, breast milk, finland2017-11-21v41 / 18approvedNo
287amnondominant snow field, mountain, depth 6-7m, japan2018-01-29v41 / 18approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v41 / 18approvedNo
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v41 / 18approvedNo
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v41 / 18approvedNo
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v41 / 18approvedNo
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v41 / 18approvedNo
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v41 / 19approvedNo
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth (water) 20m portuguese republic 2018-01-25v41 / 19approvedNo
285amnoncommon in effluent from middle ear (common homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v41 / 19approvedNo
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v41 / 19approvedNo
418amnoncommon coral, ocean, pocillopora damicornis, skeleton2018-12-02v41 / 19approvedNo
431amnonhigh freq. in midgut of hibernating bumble bees (dominant bombus terrestris, bumble bee, midgut, research facility, queen, belgium, hibernation)2018-12-16v41 / 19approvedNo
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v41 / 19approvedNo
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v41 / 19approvedNo
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v41 / 19approvedNo
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v41 / 19approvedNo
184amnoncommon peru, digestive system, ants, eciton2017-08-15v41 / 20approvedNo
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v41 / 20approvedNo
227amnoncommon in baby nasopharynx age <= 1 day (common 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v41 / 20approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v41 / 20approvedNo
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v41 / 20approvedNo
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v41 / 20approvedNo
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v41 / 20approvedNo
501amnoncommon costa rica, hamelia patens, firebush, flower, nectar2019-03-08v41 / 20approvedNo
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v41 / 20approvedNo
766amnondominant puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v41 / 20approvedNo
968amnonhuman dna ( high in top of head compared to antecubital fossa elbow in homo sapiens skin zurich switzerland )2022-12-23v11 / 20approvedNo
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v41 / 21approvedNo
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v41 / 21approvedNo
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v41 / 21approvedNo
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v41 / 21approvedNo
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v41 / 22approvedNo
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v41 / 22approvedNo
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v41 / 22approvedNo
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v41 / 22approvedNo
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v41 / 22approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 9-month-old human stage2022-12-20v41 / 22approvedNo
819amnoncommon adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v11 / 22approvedNo
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v41 / 23approvedNo
61amnondominant canis lupus familiaris, united states of america, skin, inguinal region, research facility2017-02-05v41 / 23approvedNo
63amnon high in male compared to female in homo sapiens skin 2017-02-15v41 / 23approvedNo
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v41 / 23approvedNo
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v41 / 23approvedNo
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v41 / 23approvedNo
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v41 / 23approvedNo
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v41 / 23approvedNo
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v41 / 24approvedNo
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v41 / 24approvedNo
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v41 / 24approvedNo
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v41 / 24approvedNo
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v41 / 24approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 18-month-old human stage2022-12-20v41 / 24approvedNo
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v41 / 25approvedNo
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v41 / 25approvedNo
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v41 / 25approvedNo
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v41 / 25approvedNo
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v41 / 25approvedNo
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v41 / 25approvedNo
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v41 / 25approvedNo
663amnoncommon pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v41 / 25approvedNo
968amnoncommon neck, zurich, adult, switzerland, homo sapiens, skin2022-12-23v11 / 25approvedNo
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v41 / 26approvedNo
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v41 / 26approvedNo
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v41 / 26approvedNo
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v41 / 26approvedNo
955amnondominant subgingival dental plaque, subgingival plaque, chile, dog, canis lupus familiaris2022-12-17v41 / 26approvedNo
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v41 / 27approvedNo
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v41 / 27approvedNo
674amnoncommon sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v41 / 27approvedNo
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v41 / 28approvedNo
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v41 / 28approvedNo
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v41 / 29approvedNo
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v41 / 29approvedNo
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v31 / 29approvedNo
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v41 / 30approvedNo
364amnoncommon orchesella cincta, springtail, kingdom of denmark, body proper2018-08-29v41 / 30approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v41 / 30approvedNo
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 30approvedNo
79amnoncommon skin, united states of america, physeter catodon2017-03-03v41 / 30approvedNo
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v41 / 31approvedNo
233amnon high in age age < 3 months compared to infant stage age > 3 months in feces homo sapiens infant united states of america 2017-11-05v41 / 31approvedNo
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v41 / 31approvedNo
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v41 / 31approvedNo
446amnoncommon fish, zebrafish, danio rerio, research facility, larvae, age 15d, united states of america2019-01-08v41 / 31approvedNo
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v41 / 32approvedNo
101amnoncommon state of new york, united states of america, leaf, vitis vinifera, merlot, grapevine2017-04-03v41 / 32approvedNo
717amnoncommon external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 32approvedNo
905amnon high in jejunum compared to ileum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v31 / 32approvedNo
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 33approvedNo
674amnoncommon psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v41 / 34approvedNo
977amnoncommon time 22 days, brazil, minas gerais state, canastra cheese, cheese food product2022-12-24v41 / 34approvedNo
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in 1-month-old human stage age age 1 week compared to 3-month-old human stage in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v41 / 35approvedNo
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 35approvedNo
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v41 / 35approvedNo
955amnon high in control compared to periodontitis periodontitis in chile dog canis lupus familiaris subgingival dental plaque subgingival plaque adult organism 2022-12-17v41 / 35approvedNo
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v41 / 36approvedNo
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v41 / 36approvedNo
367amnoncommon air, namibia, coast2018-09-02v41 / 36approvedNo
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v41 / 36approvedNo
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v41 / 36approvedNo
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v41 / 36approvedNo
79amnondominant skin, united states of america, delphinus delphis2017-03-03v41 / 36approvedNo
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v41 / 37approvedNo
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v41 / 37approvedNo
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v41 / 37approvedNo
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v41 / 37approvedNo
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v41 / 37approvedNo
960amnon high in 1-month-old human stage compared to 9-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 37approvedNo
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v41 / 38approvedNo
418amnoncommon coral, ocean, symphyllia, mucus2018-12-02v41 / 38approvedNo
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v11 / 38approvedNo
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 39approvedNo
360amnoncommon agave salmiana, agave, leaf, leaf endosphere, desert, guanajuato, mexico2018-08-21v41 / 39approvedNo
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v41 / 40approvedNo
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v41 / 40approvedNo
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 40approvedNo
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v41 / 40approvedNo
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 41approvedNo
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v41 / 41approvedNo
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v41 / 41approvedNo
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 41approvedNo
647amnoncommon water, state of montana, united states of america, lake, freshwater lake2020-09-06v41 / 41approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v41 / 42approvedNo
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v41 / 42approvedNo
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v41 / 42approvedNo
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v41 / 42approvedNo
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v41 / 42approvedNo
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v31 / 42approvedNo
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v41 / 42approvedNo
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v41 / 43approvedNo
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v41 / 43approvedNo
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v41 / 43approvedNo
782amnon high in age 1-2 years juvenile organism compared to age 3 years adult organism in gill sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v41 / 43approvedNo
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 43approvedNo
968amnoncommon glabella region, zurich, adult, switzerland, homo sapiens, skin2022-12-23v11 / 43approvedNo
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v41 / 44approvedNo
968amnoncommon antecubital fossa, elbow, zurich, adult, switzerland, homo sapiens, skin2022-12-23v11 / 44approvedNo
717amnoncommon dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 44approvedNo
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v41 / 45approvedNo
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v41 / 45approvedNo
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v41 / 45approvedNo
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v41 / 45approvedNo
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v41 / 46approvedNo
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v41 / 46approvedNo
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v41 / 47approvedNo
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v41 / 47approvedNo
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 47approvedNo
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v41 / 48approvedNo
674amnoncommon culicoides batesi, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v41 / 48approvedNo
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v41 / 49approvedNo
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v41 / 50approvedNo
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v41 / 51approvedNo
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v41 / 51approvedNo
782amnoncommon skin, sparus aurata, seabream, open water pond, ria formosa, portuguese republic, fish farm2021-05-07v41 / 52approvedNo
661amnoncommon lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v41 / 53approvedNo
109amnoncommon united states of america, water, drinking water, site a2017-04-08v41 / 54approvedNo
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v41 / 54approvedNo
975amnoncommon lanternfish, myctophidae, isla coronado norte, depth (water) 500-1000m, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v41 / 54approvedNo
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v41 / 55approvedNo
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v41 / 55approvedNo
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v41 / 55approvedNo
766amnoncommon in feces of dog females within 24h after parturition (common french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v41 / 55approvedNo
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 56approvedNo
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v41 / 56approvedNo
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in biofilm kingdom of spain biofilm river sediment )2017-11-22v41 / 56approvedNo
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 56approvedNo
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v41 / 57approvedNo
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v41 / 57approvedNo
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v41 / 57approvedNo
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v41 / 57approvedNo
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v41 / 57approvedNo
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v41 / 57approvedNo
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v41 / 57approvedNo
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v11 / 57approvedNo
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 57approvedNo
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v41 / 58approvedNo
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v41 / 58approvedNo
887amnoncommon hump coral, porites cylindrica, great barrier reef, coral sea, australia2022-03-28v41 / 58approvedNo
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v31 / 58approvedNo
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v41 / 59approvedNo
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v41 / 60approvedNo
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v41 / 61approvedNo
90amnoncommon douchi, china, food (fermented)2017-03-08v41 / 61approvedNo
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v41 / 61approvedNo
977amnoncommon canastra cheese, cheese curd, brazil, minas gerais state2022-12-24v41 / 61approvedNo
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v11 / 61approvedNo
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v41 / 62approvedNo
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v41 / 63approvedNo
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v41 / 64approvedNo
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v41 / 64approvedNo
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 64approvedNo
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v41 / 66approvedNo
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v41 / 66approvedNo
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v41 / 67approvedNo
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v41 / 67approvedNo
642amnon high in chub mackerel scomber japonicus skin compared to saline water sea water water in san diego pacific ocean 2020-08-28v41 / 67approvedNo
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v41 / 68approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v41 / 68approvedNo
921amnoncommon sarapiqui canton, costa rica, cane toad, bufo marinus, skin epidermis, skin2022-07-24v41 / 68approvedNo
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v41 / 69approvedNo
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v41 / 69approvedNo
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v41 / 69approvedNo
819amnon high in scalp compared to skin of cheek in age 25-45 years china adult skin female homo sapiens 2021-07-12v11 / 70approvedNo
763amnonhigher in blank compared to samples (contamination)2021-04-10v31 / 70approvedNo
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v41 / 71approvedNo
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v41 / 71approvedNo
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v41 / 71approvedNo
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v41 / 72approvedNo
817amnoncommon united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v41 / 72approvedNo
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 72approvedNo
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v41 / 73approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v41 / 74approvedNo
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 74approvedNo
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v41 / 77approvedNo
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v41 / 77approvedNo
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v41 / 77approvedNo
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v11 / 77approvedNo
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v41 / 78approvedNo
974amnoncommon in feces of marmosets reintroduced to the wild (common anal swab, captive, brazil, feces, marmosets, callithrix <genus>, monkey)2022-12-24v41 / 78approvedNo
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v41 / 80approvedNo
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v41 / 80approvedNo
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v41 / 80approvedNo
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v41 / 80approvedNo
955amnoncommon chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism2022-12-17v41 / 82approvedNo
977amnoncommon in raw milk used for cheese production (common raw milk, milk, brazil, minas gerais state)2022-12-24v41 / 82approvedNo
921amnon high in costa rica compared to puerto rico in cane toad bufo marinus skin epidermis skin 2022-07-24v41 / 83approvedNo
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v41 / 84approvedNo
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v41 / 84approvedNo
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v41 / 84approvedNo
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v41 / 85approvedNo
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v41 / 85approvedNo
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v41 / 86approvedNo
109amnoncommon united states of america, water, drinking water, site c2017-04-08v41 / 86approvedNo
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v41 / 86approvedNo
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v41 / 86approvedNo
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v41 / 86approvedNo
766amnon high in age 2 days compared to age 8 weeks in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v41 / 86approvedNo
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v41 / 87approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v41 / 88approvedNo
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v41 / 90approvedNo
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v41 / 90approvedNo
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v41 / 91approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v41 / 92approvedNo
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v41 / 94approvedNo
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v41 / 97approvedNo
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v41 / 97approvedNo
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in atlantic ocean south florida state of florida united states of america shark )2018-04-24v41 / 98approvedNo
26amnoncommon canis lupus familiaris, united states of america, saliva, mouth2016-12-05v41 / 99approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v41 / 99approvedNo
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v41 / 99approvedNo
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v41 / 100approvedNo
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v41 / 101approvedNo
766amnon high in age 2-7 years female organism adult organism compared to age 8 weeks puppy in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v41 / 101approvedNo
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v41 / 102approvedNo
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v41 / 102approvedNo
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v41 / 103approvedNo
213amnoncommon homo sapiens, south africa, vagina2017-10-22v41 / 103approvedNo
777amnon high in 2-days-old human compared to 3-month-old human stage in infant municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 104approvedNo
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v41 / 105approvedNo
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v41 / 105approvedNo
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v41 / 107approvedNo
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v41 / 107approvedNo
323amnonhigher in sharks compared to sea water ( high in shark compared to depth (water) 0cm water surface water sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v41 / 107approvedNo
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v41 / 110approvedNo
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v41 / 110approvedNo
740amnoncommon marine iguana, amblyrhynchus cristatus, ecuador, galapagos islands, cloacal swab, alimentary part of gastrointestinal system, cloaca2021-02-08v41 / 110approvedNo
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 110approvedNo
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v41 / 111approvedNo
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v41 / 111approvedNo
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v41 / 112approvedNo
912amnoncommon fresh water aquarium, research facility, whole body, body proper, zebra mussel, dreissena polymorpha, mussel2022-05-27v41 / 112approvedNo
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v41 / 113approvedNo
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v41 / 113approvedNo
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v41 / 114approvedNo
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v41 / 115approvedNo
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v41 / 115approvedNo
691amnon high in spring compared to summer in commune of paris french republic water drinking water 2028-03-11v31 / 115approvedNo
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v41 / 116approvedNo
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v31 / 116approvedNo
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v41 / 118approvedNo
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v41 / 118approvedNo
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 119approvedNo
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v41 / 120approvedNo
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v41 / 121approvedNo
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v41 / 121approvedNo
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v41 / 121approvedNo
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v41 / 123approvedNo
449amnoncommon homo sapiens, feces, colombia2019-01-09v41 / 124approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v41 / 124approvedNo
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v41 / 126approvedNo
273amnon high in 1-month-old human stage age age 1 week compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 127approvedNo
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v41 / 128approvedNo
280amnoncommon atlantic ocean, depth (water) 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v41 / 128approvedNo
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v41 / 130approvedNo
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v41 / 131approvedNo
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v41 / 131approvedNo
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v41 / 132approvedNo
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v41 / 133approvedNo
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v41 / 133approvedNo
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v41 / 134approvedNo
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v41 / 134approvedNo
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v41 / 136approvedNo
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v41 / 137approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v41 / 140approvedNo
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 140approvedNo
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v41 / 141approvedNo
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v41 / 141approvedNo
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v41 / 143approvedNo
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v41 / 144approvedNo
29amnoncommon brassica oleracea, french republic, seed2016-12-05v41 / 146approvedNo
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v41 / 147approvedNo
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v41 / 147approvedNo
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v41 / 148approvedNo
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v41 / 149approvedNo
782amnon high in sparus aurata seabream compared to seabass dicentrarchus labrax in skin open water pond ria formosa portuguese republic fish farm 2021-05-06v41 / 149approvedNo
887amnoncommon hood coral, great barrier reef, coral sea, stylophora pistillata, australia2022-03-28v41 / 151approvedNo
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v41 / 153approvedNo
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v41 / 154approvedNo
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 155approvedNo
108amnon high in colon compared to caecum in quail state of texas research facility united states of america coturnix coturnix 2017-04-07v41 / 157approvedNo
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v41 / 157approvedNo
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v41 / 161approvedNo
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v41 / 161approvedNo
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v41 / 162approvedNo
26amnoncommon united states of america, felis catus, saliva, mouth2016-12-05v41 / 163approvedNo
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth (water) 25cm 2017-10-15v41 / 166approvedNo
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v41 / 166approvedNo
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v41 / 167approvedNo
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v41 / 167approvedNo
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v41 / 169approvedNo
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v41 / 170approvedNo
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v41 / 171approvedNo
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v41 / 172approvedNo
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in gill open water pond ria formosa portuguese republic fish farm 2021-05-06v41 / 174approvedNo
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v31 / 174approvedNo
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v41 / 175approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v41 / 176approvedNo
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v41 / 176approvedNo
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v41 / 176approvedNo
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v41 / 178approvedNo
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v41 / 180approvedNo
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v41 / 184approvedNo
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v41 / 186approvedNo
158amnoncommon cat, felis catus, united states of america, saliva, mouth2017-07-06v41 / 189approvedNo
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v41 / 190approvedNo
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v41 / 193approvedNo
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v41 / 193approvedNo
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v41 / 193approvedNo
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v41 / 193approvedNo
170amnoncommon river, water, fresh water, depth (water) 10cm, united states of america, stream2017-07-24v41 / 194approvedNo
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v41 / 195approvedNo
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v41 / 198approvedNo
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v41 / 201approvedNo
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v41 / 205approvedNo
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v41 / 208approvedNo
159amnoncommon siganidae, rabbitfish, hindgut, australia2017-07-06v41 / 208approvedNo
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v41 / 210approvedNo
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v41 / 210approvedNo
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v41 / 213approvedNo
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v41 / 213approvedNo
360amnon high in summer compared to spring in desert mexico state of california soil rhizosphere 2018-08-21v41 / 214approvedNo
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v41 / 215approvedNo
975amnoncommon depth (water) 500-1000m, dragonfish, stomiidae, intestine, hindgut, gut content, pacific ocean, fish2022-12-24v41 / 226approvedNo
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v41 / 227approvedNo
545amnoncommon biofilm, depth (water) 500-1000m, depth (water) 1000-2000m, atlantic ocean, ocean, biofilm, debris, depth (water) 200-2000m2019-08-04v41 / 227approvedNo
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v41 / 228approvedNo
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v41 / 232approvedNo
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v41 / 236approvedNo
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v41 / 236approvedNo
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v41 / 236approvedNo
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v41 / 241approvedNo
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v41 / 241approvedNo
945amnon high in smoker cigarette smoking compared to non-smoker in homo sapiens oral cavity oral wash adult united states of america 2022-11-29v41 / 242approvedNo
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v41 / 243approvedNo
161amnoncommon in barn swallows in colorado (common state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v41 / 245approvedNo
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v41 / 249approvedNo
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v41 / 263approvedNo
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v41 / 267approvedNo
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in gallus gallus chicken feces united kingdom )2018-09-14v41 / 271approvedNo
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v41 / 273approvedNo
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v41 / 274approvedNo
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 275approvedNo
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v41 / 279approvedNo
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v41 / 281approvedNo
696amnon high in georissa georissa similis compared to alycaeus jagori in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v31 / 282approvedNo
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v41 / 287approvedNo
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 291approvedNo
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v41 / 298approvedNo
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v41 / 298approvedNo
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v41 / 304approvedNo
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v41 / 305approvedNo
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v31 / 306approvedNo
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v41 / 308approvedNo
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v41 / 308approvedNo
534amnoncommon river, water, fresh water, depth (water) 10cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v41 / 315approvedNo
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v41 / 320approvedNo
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v41 / 321approvedNo
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v41 / 324approvedNo
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v41 / 327approvedNo
433amnoncommon sea water, ocean, depth (water) 4m, indian ocean2018-12-19v41 / 333approvedNo
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v41 / 338approvedNo
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v41 / 345approvedNo
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth (water) 25cm in north america )2017-10-15v41 / 359approvedNo
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v41 / 362approvedNo
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v41 / 365approvedNo
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v41 / 368approvedNo
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v41 / 370approvedNo
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v41 / 374approvedNo
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v41 / 379approvedNo
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v41 / 380approvedNo
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v41 / 384approvedNo
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v41 / 387approvedNo
847amnon high in centenarian human stage eleventh decade human stage compared to ninth decade human stage in 80 year-old and over human stage feces japan 2021-12-01v11 / 387approvedNo
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth (water) 10cm united states of america stream )2017-07-24v41 / 395approvedNo
342amnoncommon water, pacific ocean, philippine sea, depth (water) 150m, sea water2018-05-28v41 / 397approvedNo
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v41 / 398approvedNo
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v41 / 399approvedNo
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v41 / 408approvedNo
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v41 / 417approvedNo
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v41 / 418approvedNo
642amnon high in gill compared to alimentary part of gastrointestinal system gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v41 / 434approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v41 / 438approvedNo
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v41 / 440approvedNo
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v41 / 456approvedNo
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v41 / 461approvedNo
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v41 / 471approvedNo
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v41 / 490approvedNo
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v41 / 492approvedNo
323amnoncommon depth (water) 0cm, depth (soil) 0-20cm, water, atlantic ocean, south florida, state of florida, united states of america, surface water, sea water2018-04-24v41 / 504approvedNo
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v41 / 505approvedNo
927amnon high in punta licosa compared to licosa island in lizard podarcis siculus italy feces 2022-08-15v31 / 509approvedNo
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v41 / 518approvedNo
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v41 / 545approvedNo
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v41 / 548approvedNo
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v41 / 559approvedNo
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v41 / 562approvedNo
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v31 / 563approvedNo
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v31 / 576approvedNo
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v41 / 579approvedNo
808amnon high in ileum compared to caecum in mucosa germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 587approvedNo
718amnon high in epilimnion compared to hypolimnion in meromictic lake "hells kitchen" lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v41 / 594approvedNo
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v41 / 609approvedNo
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v41 / 610approvedNo
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v41 / 622approvedNo
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v41 / 632approvedNo
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v41 / 645approvedNo
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v41 / 648approvedNo
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v41 / 649approvedNo
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v11 / 700approvedNo
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v41 / 727approvedNo
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v11 / 740approvedNo
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v41 / 755approvedNo
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v41 / 780approvedNo
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v31 / 786approvedNo
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v41 / 791approvedNo
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v41 / 836approvedNo
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v41 / 890approvedNo
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v41 / 946approvedNo
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v41 / 950approvedNo
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v41 / 974approvedNo
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v41 / 974approvedNo
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v41 / 1014approvedNo
18amnoncommon feces, united states of america, equus caballus2016-11-09v41 / 1071approvedNo
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v41 / 1081approvedNo
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v31 / 1092approvedNo
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v41 / 1130approvedNo
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v41 / 1175approvedNo
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v11 / 1194approvedNo
718amnon high in epilimnion compared to hypolimnion in "mary lake" ph 5.5-6 meromictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v41 / 1195approvedNo
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v41 / 1229approvedNo
808amnon high in ileal mucosa mucosa compared to digesta in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v11 / 1360approvedNo
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v41 / 1420approvedNo
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v41 / 1515approvedNo
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v41 / 1637approvedNo
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v41 / 1834approvedNo
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v41 / 2075approvedNo
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v41 / 2162approvedNo
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v41 / 2745approvedNo
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v41 / 3277approvedNo
676amnon high in fish farm aquarium compared to water inlet in french republic sea water saline water english channel coastal waters of france 2028-02-27v41 / 3729approvedNo
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v41 / 3932approvedNo
676amnon high in saline water sea water compared to biofilm saline water biofilm biofilm in aquarium fish farm french republic english channel coastal waters of france 2028-02-27v41 / 4350approvedNo
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v41 / 4853approvedNo
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v41 / 5245approvedNo
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v41 / 5596approvedNo
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v41 / 5661approvedNo
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v41 / 7954approvedNo

Problems / suggestions? Please email info AT dbbact DOT org