Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
united states of america0.374119
homo sapiens0.288082
skin0.230242
adult0.152116
research facility0.126250
feces0.103233
costa rica0.101266
infant0.091157
ant0.087336
female0.086705
digestive system0.086083
pair of nares0.084059
larval stage0.074307
state of california0.073363
nasal cavity0.073134
water0.071989
canis lupus familiaris0.071508
canada0.065018
nasopharynx0.063444
mucus0.061507
leaf0.060299
whole body0.059524
poland0.057971
china0.056782
belgium0.054895
desert0.054299
felis catus0.053333
air0.052335
australia0.051948
bird0.051437
germany0.049791
beetle0.049155
mexico0.048855
city0.048428
river0.048091
dog0.046670
stomach0.046310
sweden0.045489
soil0.044280
child0.043197
state of michigan0.042521
wild0.042384
age0.041854
sus scrofa0.040996
pig0.040996
cat0.040984
french republic0.039949
farm0.039565
fish0.039554
mus musculus0.039227
mouth0.038944
sea water0.038901
fresh water0.038662
brazil0.038439
duodenum0.036980
urocyon littoralis0.036866
urocyon littoralis catalinae0.036866
santa catalina island fox0.036866
atlantic ocean0.036697
santa catalina island0.036199
ocean0.036069
intestine0.035057
coral0.034091
LOWER IN feces0.033841
mouse0.033827
united kingdom0.033670
province of ontario0.033333
epidermis0.032787
age 25-45 years0.031153
kingdom of denmark0.030912
foodon product type0.030675
breast milk0.030441
ileum0.030441
state of florida0.029542
1-month-old human stage0.028037
state of wyoming0.027907
centrocercus urophasianus0.027907
greater sage-grouse0.027907
guanajuato0.027907
lung0.027907
herbivorous beetle0.027907
tonsil0.027714
LOWER IN saliva0.027650
dentition0.027211
plant0.027149
control0.026277
frog0.025008
vagina0.024883
nida basin0.024883
oncorhynchus mykiss0.024883
rainbow trout0.024883
body proper0.024822
commonwealth of pennsylvania0.024806
japan0.024578
pond0.024578
hospital0.024477
external acoustic meatus0.022001
ear canal0.022001
foot0.021961
depth (water) 10cm0.021961
Fraction of dbbact annotations with this term covered by the query
TermScore
mucus0.857143
nasal cavity0.818182
skin0.818182
urine0.800000
gill0.800000
trachea0.750000
external acoustic meatus0.750000
ear canal0.750000
air0.750000
inguinal region0.750000
pair of nares0.714286
LOWER IN infant stage0.666667
tracheal aspirate0.666667
nipple0.666667
foot0.666667
2-month-old human stage0.666667
crematogaster0.666667
skin of cheek0.666667
age 25-45 years0.666667
conjunctiva0.666667
building0.666667
paranasal sinus0.666667
sinusoidal space0.666667
floor0.666667
poland0.666667
beetle0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
nasal cavity mucosa0.666667
middle ear0.666667
dense settlement biome0.666667
depth (water) 10cm0.666667
megaptera novaeangliae0.666667
humpback whale0.666667
coelomic fluid0.666667
galapagos islands0.666667
state of idaho0.666667
portuguese republic0.666667
bombus terrestris0.666667
nectar0.666667
bronchus0.666667
LOWER IN hindgut0.666667
vitis vinifera0.666667
uropygial gland0.666667
dorsum0.666667
stream0.666667
newt0.666667
LOWER IN nasopharynx0.666667
rana catesbeiana0.666667
bullfrog0.666667
cactus0.666667
LOWER IN stem0.666667
ph 6.90.666667
belgium0.625000
frog0.625000
1-month-old human stage0.600000
nasopharynx0.600000
coral0.600000
axilla0.600000
state of tennessee0.600000
sputum0.600000
flower0.600000
aquarium0.600000
hawaii0.600000
infant0.583333
mexico0.571429
LOWER IN mouth0.571429
leaf0.550000
duodenum0.545455
french republic0.545455
LOWER IN gizzard0.500000
state of wyoming0.500000
bird0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
LOWER IN newborn human stage0.500000
ant0.500000
LOWER IN lower respiratory tract disease0.500000
respiratory technology dependent0.500000
salami0.500000
ants0.500000
desert0.500000
guanajuato0.500000
tissue0.500000
acropora hyacinthus0.500000
neoponera0.500000
pseudomyrmex spinicola0.500000
pheidole0.500000
pseudomyrmex cubaensis0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
lung0.500000
mild disease course0.500000
state of new hampshire0.500000
protected brush sampling0.500000
curd0.500000
cheese food product0.500000
camembert cheese food product0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.411483
homo sapiens0.301435
adult0.137161
skin0.133971
research facility0.089314
feces0.087719
costa rica0.057416
female0.052632
infant0.049442
ant0.047847
digestive system0.047847
pair of nares0.044657
china0.043062
larval stage0.041467
water0.041467
canis lupus familiaris0.039872
state of california0.039872
nasal cavity0.038278
canada0.036683
nasopharynx0.033493
mucus0.031898
whole body0.031898
leaf0.031898
poland0.030303
felis catus0.030303
desert0.028708
soil0.028708
australia0.028708
belgium0.028708
bird0.027113
air0.027113
germany0.027113
mexico0.025518
dog0.025518
stomach0.025518
wild0.025518
city0.025518
beetle0.025518
river0.025518
child0.023923
sweden0.023923
cat0.023923
farm0.023923
age0.022329
sus scrofa0.022329
state of michigan0.022329
pig0.022329
mus musculus0.022329
sea water0.020734
french republic0.020734
fresh water0.020734
fish0.020734
brazil0.020734
mouth0.020734
duodenum0.019139
ocean0.019139
santa catalina island0.019139
urocyon littoralis0.019139
urocyon littoralis catalinae0.019139
santa catalina island fox0.019139
intestine0.019139
mouse0.019139
atlantic ocean0.019139
control0.017544
coral0.017544
province of ontario0.017544
epidermis0.017544
united kingdom0.017544
LOWER IN feces0.017544
foodon product type0.015949
breast milk0.015949
ileum0.015949
age 25-45 years0.015949
kingdom of denmark0.015949
state of florida0.015949
state of wyoming0.014354
centrocercus urophasianus0.014354
greater sage-grouse0.014354
1-month-old human stage0.014354
guanajuato0.014354
lung0.014354
plant0.014354
herbivorous beetle0.014354
tonsil0.014354
dentition0.014354
LOWER IN saliva0.014354
vagina0.012759
japan0.012759
hospital0.012759
nida basin0.012759
commonwealth of pennsylvania0.012759
frog0.012759
oncorhynchus mykiss0.012759
rainbow trout0.012759
body proper0.012759
pond0.012759
kingdom of the netherlands0.011164
peru0.011164
ants0.011164
cultivated environment0.011164
Exp. ID User ID Description Date Region Flag Sequences
558amnon high in duodenum compared to gizzard in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 1
227amnonpeaks at age 1 month in baby nasopharynx ( high in age 1-month-old human stage compared to newborn human stage infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
408amnon high in larval stage compared to stomach in united states of america costa rica camponotus ant 2018-11-22v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
74amnondominant united states of america, salami, foodon product type2017-02-27v4No1 / 3
184amnoncommon digestive system, peru, ants, pseudomyrmex2017-08-15v4No1 / 4
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 4
360amnondominant desert, soil, mexico, guanajuato2018-08-21v4No1 / 4
418amnoncommon ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 4
74amnoncommon united states of america, salami, foodon product type2017-02-27v4No1 / 5
184amnoncommon digestive system, peru, ants, neoponera2017-08-15v4No1 / 5
301amnon high in duodenum ileum compared to rectum colon in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 5
408amnoncommon united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 5
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 6
582amnondominant united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 6
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 6
52amnoncommon homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 7
74amnondominant united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
184amnoncommon digestive system, peru, ants, azteca2017-08-15v4No1 / 7
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 7
397amnoncommon digestive system, intestine, panama, fungus growing ant, atta colombica2018-11-14v4No1 / 7
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 7
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 7
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, foot, australia)2017-11-05v4No1 / 8
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 8
284amnon high in age 2 months compared to 12-month-old human stage in feces homo sapiens female infant state of california 2018-01-27v4No1 / 8
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 8
516amnoncommon homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 8
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 8
749amnondominant homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 8
819amnondominant homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 8
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 8
92amnoncommon air, japan2017-03-09v4No1 / 9
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 9
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v4No1 / 9
244amnondominant digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
408amnondominant united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 9
418amnoncommon ocean, tissue, coral, echinopora mammiformis2018-12-02v4No1 / 9
819amnondominant homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
26amnondominant united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 10
58amnondominant homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
354amnondominant homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 10
523amnondominant united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 10
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
749amnondominant homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 10
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 11
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
370amnondominant desert, air, gobi desert2018-09-06v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (dominant city, air, hong kong, subway)2019-01-20v4No1 / 11
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
533amnoncommon homo sapiens, nasopharynx, infant, fiji, 12-month-old human stage2019-07-22v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 11
567amnoncommon homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 11
664amnoncommon canis lupus familiaris, thailand, dog, blood, bangkok, semi domestic dog2020-09-22v4No1 / 11
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 11
26amnondominant united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 12
26amnondominant homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 12
74amnoncommon united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 12
75amnondominant homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
184amnoncommon digestive system, peru, ants, crematogaster2017-08-15v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 12
301amnondominant united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 12
370amnoncommon desert, air, gobi desert2018-09-06v4No1 / 12
397amnondominant digestive system, intestine, panama, fungus growing ant, atta colombica2018-11-14v4No1 / 12
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 12
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
567amnoncommon homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
582amnondominant united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
766amnoncommon feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 12
684amnondominant homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 12
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 12
35amnondominant homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 13
48amnondominant homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
199amnonhigh freq. on shower wall tile (dominant united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
534amnondominant river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 13
567amnondominant homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
647amnoncommon in skin of columbia spotted frog (common united states of america, lake, skin, frog, state of montana, rana luteiventris, columbia spotted frog)2020-09-06v4No1 / 13
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
7amnondominant homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 14
58amnondominant homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 14
158amnondominant united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 14
158amnondominant united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 14
209amnonhigh freq. in whale blow condensate (dominant respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, foot, ulcer, australia, wound, diabetes mellitus)2017-11-05v4No1 / 14
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, foot, ulcer, australia, wound, diabetes mellitus)2017-11-05v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
277amnondominant homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
418amnoncommon ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
475amnonhigh freq. in air next to subway stations in hong kong (dominant city, air, hong kong)2019-01-20v4No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
684amnoncommon homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 14
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 15
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 15
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant air, french republic, autumn, cloud)2017-11-22v4No1 / 15
291amnondominant nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 15
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 15
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
550amnon high in coelomic fluid wild starfish patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 15
819amnoncommon homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 15
74amnoncommon united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 16
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
198amnondominant united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 16
440amnondominant feces, geospiza fortis, galapagos islands, bird, finch, medium ground finch2019-01-06v4No1 / 16
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 16
582amnondominant united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 16
607amnondominant homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 16
645amnondominant cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 16
663amnondominant homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
621amnondominant body proper, australia, whole body, tick, ixodes antechini2020-05-07v1No1 / 16
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 16
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
184amnoncommon digestive system, peru, ants, myrmelachista2017-08-15v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 17
277amnondominant homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
418amnondominant ocean, skeleton, coral, acropora hyacinthus2018-12-02v4No1 / 17
418amnondominant ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 17
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
158amnondominant united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 18
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
287amnondominant mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 18
418amnoncommon ocean, mucus, coral, isopora palifera2018-12-02v4No1 / 18
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
607amnondominant homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 18
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
280amnon high in coral reef eunicella labiata gorgonian coral coral compared to marine water body saline water sea water in atlantic ocean portuguese republic depth (water) 20m 2018-01-25v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
418amnoncommon ocean, skeleton, coral, pocillopora damicornis2018-12-02v4No1 / 19
431amnonhigh freq. in midgut of hibernating bumble bees (dominant research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 19
558amnondominant united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 19
567amnondominant homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
582amnondominant united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
607amnoncommon homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 19
184amnoncommon digestive system, peru, ants, eciton2017-08-15v4No1 / 20
184amnoncommon digestive system, peru, ants, odontomachus2017-08-15v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
501amnoncommon nectar, costa rica, flower, hamelia patens, firebush2019-03-08v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
158amnoncommon united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 22
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
819amnoncommon homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
61amnondominant united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 23
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
558amnondominant united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
338amnon high in adult compared to larval stage tadpole amphibian larval stage in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 24
354amnon high in sputum induced sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
489amnoncommon feces, french republic, anal swab, myotis myotis, bat, greater mouse eared bat2019-02-25v4No1 / 24
13amnon high in stomach esophagus duodenum ileum mouth compared to feces rectum caecum colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 25
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 25
159amnon high in midgut compared to hindgut in australia siganidae rabbitfish 2017-07-06v4No1 / 25
181amnoncommon digestive system, research facility, belgium, bombus terrestris, bumblebee2017-08-15v4No1 / 25
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 25
607amnoncommon homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
275amnoncommon skin, antarctica, antarctic peninsula, megaptera novaeangliae, humpback whale2018-01-16v4No1 / 26
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
499amnoncommon digestive system, pond, intestine, brazil, ranatra, water stick-insect2019-03-05v4No1 / 26
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 27
674amnoncommon female, body proper, panama, whole body, lutzomyia gomezi, sand fly2020-09-28v4No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
81amnoncommon cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 30
364amnoncommon body proper, orchesella cincta, kingdom of denmark, springtail2018-08-29v4No1 / 30
582amnoncommon united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 30
79amnoncommon united states of america, skin, physeter catodon2017-03-03v4No1 / 30
191amnoncommon homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
446amnoncommon united states of america, research facility, danio rerio, fish, zebrafish, larvae, age 15d2019-01-08v4No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
101amnoncommon united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 32
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
674amnoncommon female, body proper, panama, whole body, psychodopygus panamensis, sand fly2020-09-28v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
79amnondominant united states of america, skin, delphinus delphis2017-03-03v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
158amnoncommon united states of america, axilla, felis catus, cat2017-07-06v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
243amnoncommon digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 38
418amnoncommon ocean, mucus, coral, symphyllia2018-12-02v4No1 / 38
528amnon high in caucasian compared to african american african in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in cheek dentition compared to saliva in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 39
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave salmiana2018-08-21v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
647amnoncommon united states of america, lake, water, state of montana, freshwater lake2020-09-06v4No1 / 41
95amnoncommon in root canal (common homo sapiens, tooth, brazil, root canal)2017-03-12v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
595amnoncommon switzerland, whole body, ixodes ricinus, castor bean tick2020-03-16v4No1 / 42
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
89amnoncommon uropygial gland, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 43
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, paederidus ruficollis2019-04-18v4No1 / 45
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
392amnon high in larvae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
89amnoncommon cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 48
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 51
782amnoncommon fish farm, skin, portuguese republic, sparus aurata, ria formosa, open water pond, seabream2021-05-07v4No1 / 52
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, larvae insect diet2018-11-05v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 56
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in river sediment biofilm kingdom of spain )2017-11-22v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
237amnoncommon uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 58
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in sea water bermuda )2016-10-27v4No1 / 61
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in digestive system costa rica butterfly )2019-03-09v4No1 / 64
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
341amnoncommon united states of america, water, fresh water, drinking water, tap water, state of illinois2018-05-28v4No1 / 66
558amnoncommon united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 66
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
642amnon high in skin scomber japonicus chub mackerel compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
582amnoncommon united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 68
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
819amnon high in scalp compared to skin of cheek in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho bird captive gymnogyps californianus california condor 2020-09-03v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
99amnoncommon united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 74
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens nasopharynx infant australia )2017-04-16v4No1 / 80
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
311amnoncommon in salted cabbage (common united states of america, state of rhode island, cabbage, foodon product type)2018-04-09v4No1 / 85
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, patiria pectinifera, japan2019-08-18v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in respiratory airway north america megaptera novaeangliae humpback whale exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
582amnoncommon united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 92
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in united states of america atlantic ocean state of florida south florida shark )2018-04-24v4No1 / 98
26amnoncommon united states of america, saliva, canis lupus familiaris, mouth2016-12-05v4No1 / 99
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
563amnon high in hiv infection compared to control in feces homo sapiens united states of america homosexual msm male rectal swab 2019-11-18v4No1 / 100
201amnoncommon in cactus fly whole body (common desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 101
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, dendropsophus minutus2019-03-05v4No1 / 102
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, vagina, south africa2017-10-22v4No1 / 103
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
582amnon high in external acoustic meatus ear canal compared to lip labial commissure in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 105
79amnoncommon united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth (water) 0cm in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
740amnoncommon cloaca, ecuador, galapagos islands, alimentary part of gastrointestinal system, amblyrhynchus cristatus, cloacal swab, marine iguana2021-02-08v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
613amnoncommon research facility, aquarium, gastrointestinal system, poland, fish, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 116
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
323amnoncommon freq. in shark teeth (common united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
582amnoncommon united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 124
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth (water) 20m, eunicella labiata, gorgonian coral, coral2018-01-25v4No1 / 128
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion modestum2019-04-18v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 134
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
615amnoncommon leaf, brazil, leaf surface, greenhouse, exosphere, campinas, saccharum, sugarcane2020-04-27v4No1 / 143
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm skin portuguese republic ria formosa open water pond 2021-05-06v4No1 / 149
392amnon high in pre pupae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 153
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
26amnoncommon united states of america, saliva, felis catus, mouth2016-12-05v4No1 / 163
209amnon high in atlantic ocean cape cod canal compared to vancouver pacific ocean in ocean sea water north america depth (water) 25cm 2017-10-15v4No1 / 166
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
159amnoncommon midgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 169
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 170
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm gill portuguese republic ria formosa open water pond 2021-05-06v4No1 / 174
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 176
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
499amnoncommon digestive system, pond, intestine, tadpole, brazil, frog, scinax fuscovarius2019-03-05v4No1 / 176
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
158amnoncommon united states of america, saliva, felis catus, cat, mouth2017-07-06v4No1 / 189
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
534amnoncommon river, tributary, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth (water) 10cm2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
515amnoncommon river, poland, whole body, beetle, bembidion decorum, carnivorous beetle, raba river2019-04-18v4No1 / 198
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
159amnoncommon hindgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 208
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
360amnon high in summer compared to spring in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
545amnoncommon ocean, biofilm, atlantic ocean, debris, depth (water) 200-2000m, depth (water) 500-1000m, depth (water) 1000-2000m2019-08-04v4No1 / 227
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
342amnoncommon water, surface water, sea water, pacific ocean, philippine sea2018-05-28v4No1 / 236
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 271
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 287
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion punctulatum2019-04-18v4No1 / 305
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion varicolor2019-04-18v4No1 / 308
534amnoncommon river, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
433amnoncommon ocean, sea water, indian ocean, depth (water) 4m2018-12-19v4No1 / 333
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
93amnoncommon in seawater near the shore in hawaii (common shore, sea water, hawaii)2017-03-12v4No1 / 345
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth (water) 25cm in north america )2017-10-15v4No1 / 359
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 395
342amnoncommon water, sea water, pacific ocean, philippine sea, depth (water) 150m2018-05-28v4No1 / 397
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
642amnon high in gill compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 434
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
28amnon high in leaf whole plant compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
375amnoncommon in oil contaminated desert soil (common desert, soil, oil contaminated soil, kuwait)2018-09-09v4No1 / 490
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
323amnoncommon united states of america, water, surface water, sea water, atlantic ocean, state of florida, south florida, depth (soil) 0-20cm, depth (water) 0cm2018-04-24v4No1 / 504
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
548amnoncommon on leaf surface (common leaf, brazil, minas gerais state, campos rupestres, vellozia epidendroides)2019-08-17v4No1 / 548
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
308amnoncommon united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 579
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake "hells kitchen" lake 2028-05-23v4No1 / 594
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 609
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil water soilwater in canada province of quebec )2017-12-11v4No1 / 610
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 632
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common soil, rhizosphere, triticum aestivum, germany, bonn, haplic luvisol, ph 6.9, campus klein-altendorf, silty clay loam, depth (soil) 75-105cm)2021-07-14v1No1 / 700
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 727
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in soil rhizosphere triticum aestivum germany bonn haplic luvisol ph 6.9 campus klein-altendorf silty clay loam )2021-07-14v1No1 / 740
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 755
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1071
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 1195
423amnon high in no human contact chernobyl exclusion zone compared to human contact in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 1229
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
101amnon high in root compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 2075
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
236amnon high in sediment marine sediment compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 2745
265amnon high in water soilwater compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
676amnon high in fish farm aquarium compared to water inlet in saline water sea water french republic english channel coastal waters of france 2028-02-27v4No1 / 3729
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
676amnon high in saline water sea water compared to biofilm saline water biofilm in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 4350
271amnon high in soil compared to rhizosphere glycine max soybean in china depth (soil) 0-20cm 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org