Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
united states of america0.378131
homo sapiens0.296839
skin0.211435
adult0.151946
research facility0.123599
feces0.107074
costa rica0.105263
infant0.092199
ant0.090909
digestive system0.089552
pair of nares0.087995
larval stage0.077289
state of california0.076655
nasal cavity0.076271
canada0.075225
canis lupus familiaris0.075000
water0.074784
female0.068460
nasopharynx0.066142
mucus0.064171
leaf0.062857
whole body0.062500
poland0.062346
belgium0.057252
desert0.057007
felis catus0.055434
air0.054604
australia0.054299
bird0.053628
mexico0.051282
beetle0.051282
city0.050491
river0.050125
dog0.048980
stomach0.048193
child0.045455
wild0.044944
sweden0.044192
age0.043614
cat0.042553
french republic0.041678
farm0.041451
fish0.041248
mouth0.040792
mus musculus0.040769
sea water0.040613
fresh water0.040415
germany0.040037
brazil0.040037
pig0.039354
sus scrofa0.039354
duodenum0.038710
urocyon littoralis catalinae0.038462
santa catalina island fox0.038462
santa catalina island0.038462
urocyon littoralis0.038462
atlantic ocean0.038278
state of michigan0.037975
ocean0.037594
intestine0.036765
china0.036218
coral0.035580
epidermis0.035370
LOWER IN feces0.035370
united kingdom0.035245
mouse0.035165
province of ontario0.034755
foodon product type0.032000
breast milk0.031746
state of florida0.030769
lung0.029211
centrocercus urophasianus0.029126
greater sage-grouse0.029126
state of wyoming0.029126
guanajuato0.029126
herbivorous beetle0.029126
LOWER IN saliva0.029056
kingdom of denmark0.028986
tonsil0.028916
dentition0.028504
plant0.028302
control0.027611
soil0.027397
pond0.026432
frog0.026110
vagina0.026042
nida basin0.025974
rainbow trout0.025974
oncorhynchus mykiss0.025974
body proper0.025974
japan0.025907
ileum0.025641
hospital0.025532
ear canal0.022976
external acoustic meatus0.022976
foot0.022932
ants0.022801
depth 10 cm0.022801
cloaca0.022801
agave0.022801
Fraction of dbbact annotations with this term covered by the query
TermScore
canada2.000000
poland2.000000
trachea1.500000
pond1.500000
LOWER IN colon1.333333
LOWER IN caecum1.250000
san diego1.000000
mucus0.857143
nasal cavity0.818182
skin0.806452
urine0.800000
pair of nares0.769231
ear canal0.750000
external acoustic meatus0.750000
air0.750000
inguinal region0.750000
sputum0.750000
gill0.750000
hawaii0.750000
tracheal aspirate0.666667
mexico0.666667
nipple0.666667
foot0.666667
crematogaster0.666667
conjunctiva0.666667
building0.666667
state of illinois0.666667
sinusoidal space0.666667
paranasal sinus0.666667
floor0.666667
beetle0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
middle ear0.666667
dense settlement biome0.666667
nasal cavity mucosa0.666667
megaptera novaeangliae0.666667
humpback whale0.666667
coelomic fluid0.666667
galapagos islands0.666667
state of idaho0.666667
bombus terrestris0.666667
nectar0.666667
bronchus0.666667
LOWER IN hindgut0.666667
vitis vinifera0.666667
freshwater lake0.666667
uropygial gland0.666667
dorsum0.666667
stream0.666667
puerto rico0.666667
colon0.666667
newt0.666667
LOWER IN nasopharynx0.666667
rana catesbeiana0.666667
bullfrog0.666667
cactus0.666667
LOWER IN stem0.666667
belgium0.625000
frog0.625000
duodenum0.600000
nasopharynx0.600000
coral0.600000
axilla0.600000
filtered 0.2um0.600000
state of tennessee0.600000
flower0.600000
aquarium0.600000
infant0.590909
desert0.571429
india0.571429
LOWER IN mouth0.571429
lung0.555556
vagina0.555556
leaf0.550000
french republic0.545455
bird0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
LOWER IN gizzard0.500000
age 1 month0.500000
LOWER IN age > 1 month0.500000
LOWER IN age < 1 month0.500000
ant0.500000
respiratory technology dependent0.500000
LOWER IN lower respiratory tract disease0.500000
salami0.500000
ants0.500000
guanajuato0.500000
acropora hyacinthus0.500000
tissue0.500000
neoponera0.500000
pseudomyrmex spinicola0.500000
pheidole0.500000
pseudomyrmex cubaensis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.418333
homo sapiens0.298333
adult0.128333
skin0.121667
feces0.090000
research facility0.086667
costa rica0.060000
infant0.050000
ant0.050000
digestive system0.050000
pair of nares0.046667
larval stage0.043333
water0.043333
canis lupus familiaris0.041667
state of california0.041667
nasal cavity0.040000
female0.040000
canada0.038333
nasopharynx0.035000
mucus0.033333
whole body0.033333
leaf0.033333
poland0.031667
felis catus0.031667
desert0.030000
australia0.030000
belgium0.030000
bird0.028333
air0.028333
mexico0.026667
dog0.026667
stomach0.026667
wild0.026667
city0.026667
beetle0.026667
river0.026667
child0.025000
cat0.025000
farm0.025000
age0.023333
china0.023333
sweden0.023333
mus musculus0.023333
sea water0.021667
fresh water0.021667
pig0.021667
sus scrofa0.021667
french republic0.021667
germany0.021667
fish0.021667
brazil0.021667
mouth0.021667
duodenum0.020000
ocean0.020000
urocyon littoralis catalinae0.020000
santa catalina island fox0.020000
santa catalina island0.020000
urocyon littoralis0.020000
intestine0.020000
state of michigan0.020000
mouse0.020000
atlantic ocean0.020000
control0.018333
coral0.018333
united kingdom0.018333
province of ontario0.018333
epidermis0.018333
LOWER IN feces0.018333
foodon product type0.016667
breast milk0.016667
soil0.016667
state of florida0.016667
centrocercus urophasianus0.015000
greater sage-grouse0.015000
state of wyoming0.015000
guanajuato0.015000
lung0.015000
plant0.015000
herbivorous beetle0.015000
kingdom of denmark0.015000
tonsil0.015000
dentition0.015000
LOWER IN saliva0.015000
ileum0.013333
vagina0.013333
japan0.013333
hospital0.013333
nida basin0.013333
frog0.013333
rainbow trout0.013333
oncorhynchus mykiss0.013333
body proper0.013333
pond0.013333
kingdom of the netherlands0.011667
peru0.011667
ants0.011667
cultivated environment0.011667
ear canal0.011667
external acoustic meatus0.011667
foot0.011667
Exp. ID User ID Description Date Region Flag Sequences
558amnon high in duodenum compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / -7
227amnonpeaks at age 1 month in baby nasopharynx ( high in age age 1 month compared to age > 1 month age < 1 month in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / -6
408amnon high in larval stage compared to stomach in ant costa rica united states of america camponotus 2018-11-22v4No1 / -6
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / -6
74amnondominant salami, united states of america, foodon product type2017-02-27v4No1 / -5
184amnoncommon peru, digestive system, ants, pseudomyrmex2017-08-15v4No1 / -4
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / -4
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / -4
360amnondominant desert, soil, mexico, guanajuato2018-08-21v4No1 / -4
418amnoncommon coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / -4
74amnoncommon salami, united states of america, foodon product type2017-02-27v4No1 / -3
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v4No1 / -3
301amnon high in duodenum ileum compared to colon rectum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / -3
408amnondominant ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / -3
408amnoncommon ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / -3
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / -3
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / -2
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / -2
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / -2
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / -2
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -2
52amnoncommon homo sapiens, skin, nipple, state of california2017-01-19v4No1 / -1
74amnondominant curd, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / -1
184amnoncommon peru, digestive system, azteca, ants2017-08-15v4No1 / -1
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / -1
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / -1
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, larval stage2018-11-22v4No1 / -1
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / -1
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / -1
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / -1
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / -1
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -1
232amnonhigh freq. in foot of healthy controls (dominant homo sapiens, skin, australia, foot)2017-11-05v4No1 / 0
232amnonhigh freq. in foot of diabetic patients (dominant homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 0
284amnon high in age 2 months compared to age 1 year in homo sapiens female feces state of california infant 2018-01-27v4No1 / 0
332amnoncommon homo sapiens, infant, vellore district, city, age 2 months, india2018-05-14v4No1 / 0
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 0
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 0
408amnondominant ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 0
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 0
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 0
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 0
92amnoncommon air, japan2017-03-09v4No1 / 1
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 1
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v4No1 / 1
244amnondominant drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 1
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 1
408amnondominant ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 1
418amnoncommon coral, ocean, echinopora mammiformis, tissue2018-12-02v4No1 / 1
717amnondominant upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 1
26amnondominant canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 2
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 2
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 2
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 1 year)2017-10-30v4No1 / 2
354amnondominant homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 2
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 2
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 2
523amnondominant air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 2
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 2
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 3
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 3
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v4No1 / 3
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 3
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 3
370amnondominant desert, air, gobi desert2018-09-06v4No1 / 3
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 3
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 3
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 3
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 3
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v4No1 / 3
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 3
533amnoncommon homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 3
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 3
567amnoncommon belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 3
664amnoncommon blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v4No1 / 3
26amnondominant united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 4
26amnondominant homo sapiens, united states of america, pair of nares, mucus2016-12-05v4No1 / 4
74amnoncommon curd, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 4
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 4
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v4No1 / 4
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 4
301amnondominant canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 4
370amnoncommon desert, air, gobi desert2018-09-06v4No1 / 4
397amnondominant panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 4
408amnondominant ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 4
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 4
408amnondominant ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 4
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 4
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 4
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 4
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v3No1 / 4
717amnondominant plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 4
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 5
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 5
63amnonhigh freq. in skin in american gut (dominant skin, homo sapiens)2017-02-15v4No1 / 5
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 5
199amnonhigh freq. on shower wall tile (dominant bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 5
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 5
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 5
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 5
567amnondominant belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 5
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 5
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v3No1 / 5
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 5
647amnoncommon in skin of columbia spotted frog (common lake, rana luteiventris, columbia spotted frog, frog, skin, united states of america, state of montana)2020-09-06v4No1 / 5
669amnoncommon age 2 months, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 5
684amnondominant middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 5
717amnondominant palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 5
717amnondominant external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 5
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 6
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 6
158amnondominant cat, felis catus, united states of america, conjunctiva2017-07-06v4No1 / 6
158amnondominant united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 6
209amnonhigh freq. in whale blow condensate (dominant north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 6
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 6
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 6
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 6
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 6
277amnondominant homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 6
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 6
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 6
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 6
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 6
418amnoncommon coral, ocean, porites cylindrica, tissue2018-12-02v4No1 / 6
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 6
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 6
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v4No1 / 6
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 7
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 7
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 7
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 7
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 7
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 7
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant cloud, french republic, air, autumn)2017-11-22v4No1 / 7
291amnondominant canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 7
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 7
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 7
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 7
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 7
550amnon high in starfish coelomic fluid wild patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 7
684amnoncommon middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 7
74amnoncommon rind, united states of america, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 8
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 8
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 8
198amnondominant yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 8
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 8
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 8
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 8
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 8
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 8
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 8
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 8
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 8
645amnondominant cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 8
663amnondominant pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 8
749amnondominant seoul, age 20-30 years, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 8
158amnondominant cat, felis catus, united states of america, axilla2017-07-06v4No1 / 9
184amnoncommon peru, digestive system, myrmelachista, ants2017-08-15v4No1 / 9
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 9
277amnondominant homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 9
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 9
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 9
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 9
418amnondominant coral, ocean, acropora hyacinthus, skeleton2018-12-02v4No1 / 9
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 9
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 9
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 9
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 9
717amnondominant upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 9
158amnondominant cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 10
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 10
287amnondominant snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 10
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 10
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v4No1 / 10
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 10
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 10
749amnondominant skin of forehead, seoul, age 20-30 years, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 10
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 11
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 11
285amnoncommon in effluent from middle ear (common homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 11
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 11
418amnoncommon coral, ocean, pocillopora damicornis, skeleton2018-12-02v4No1 / 11
431amnonhigh freq. in midgut of hibernating bumble bees (dominant bombus terrestris, bumble bee, midgut, research facility, queen, belgium, hibernation)2018-12-16v4No1 / 11
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 11
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 11
582amnondominant urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 11
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 11
184amnoncommon peru, digestive system, ants, eciton2017-08-15v4No1 / 12
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 12
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 12
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 12
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 12
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 12
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 12
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 12
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 12
501amnoncommon costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 12
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 12
766amnoncommon puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 12
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 13
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 13
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 13
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 13
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 14
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 14
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 14
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 14
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
61amnondominant canis lupus familiaris, united states of america, skin, inguinal region, research facility2017-02-05v4No1 / 15
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 15
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 15
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 15
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 15
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 15
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 15
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 16
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 16
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 16
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 16
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 16
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 16
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 17
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 17
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 17
159amnon high in midgut compared to hindgut in siganidae rabbitfish australia 2017-07-06v4No1 / 17
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 17
348amnonsuspected contaminant (found in H2O samples) (contamination)2018-07-16v4No1 / 17
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 17
663amnoncommon pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 17
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 18
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 18
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 18
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 18
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 19
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 19
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 20
674amnoncommon sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v4No1 / 20
766amnondominant puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 20
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 21
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 21
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 21
79amnoncommon skin, united states of america, physeter catodon2017-03-03v4No1 / 22
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 22
364amnoncommon orchesella cincta, springtail, kingdom of denmark, body proper2018-08-29v4No1 / 22
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, ear canal, external acoustic meatus2020-01-22v4No1 / 22
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 23
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 23
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 23
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 23
446amnoncommon fish, zebrafish, danio rerio, research facility, larvae, age 15d, united states of america2019-01-08v4No1 / 23
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 24
101amnoncommon united states of america, leaf, vitis vinifera, merlot, grapevine, new york2017-04-03v4No1 / 24
717amnoncommon external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 25
669amnon high in age 2 weeks compared to age 1 year in sweden infant feces homo sapiens 2020-09-26v4No1 / 26
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 27
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 27
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 27
674amnoncommon psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 27
79amnondominant skin, united states of america, delphinus delphis2017-03-03v4No1 / 28
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 28
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 28
367amnoncommon air, namibia, coast2018-09-02v4No1 / 28
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 28
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 29
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 29
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 29
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 29
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 29
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 30
418amnoncommon coral, ocean, symphyllia, mucus2018-12-02v4No1 / 30
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 30
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 31
360amnoncommon agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 31
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 32
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 32
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 32
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 33
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 33
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 33
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 33
647amnoncommon water, state of montana, united states of america, lake, freshwater lake2020-09-06v4No1 / 33
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 34
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 34
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 34
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 34
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 34
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 35
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 35
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 35
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 36
749amnoncommon seoul, age 20-30 years, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon skin of forehead, seoul, age 20-30 years, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 37
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 37
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v4No1 / 37
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 37
717amnoncommon dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 37
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 38
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 38
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 39
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 39
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 40
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 40
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 41
674amnoncommon culicoides batesi, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 41
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 42
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v3No1 / 42
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in andrias japonicus japanese giant salamander skin japan )2018-05-21v4No1 / 43
661amnoncommon lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 45
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 46
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 46
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 47
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 47
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces infant india )2016-12-19v4No1 / 48
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 48
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in kingdom of spain biofilm river sediment )2017-11-22v4No1 / 48
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 48
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 49
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 49
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 49
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 49
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 49
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 49
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 49
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 49
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 50
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 50
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 50
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 51
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 51
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 52
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 53
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 53
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 53
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 54
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 55
766amnoncommon in feces of dog females within 24h after parturition (common french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v4No1 / 55
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 56
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 56
671amnon high in age 1 month compared to age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 57
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v4No1 / 57
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 58
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 58
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 59
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 59
642amnon high in chub mackerel scomber japonicus skin compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 59
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 60
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 60
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 61
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 61
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 61
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 63
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 63
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 63
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 64
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 64
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 65
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 66
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 69
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 69
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 69
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 72
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 72
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 72
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 76
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 76
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 76
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 77
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 77
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 78
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 78
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 78
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 78
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 78
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 79
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 80
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 82
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 82
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 83
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 84
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 86
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 89
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 89
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in atlantic ocean south florida state of florida united states of america shark )2018-04-24v4No1 / 90
26amnoncommon canis lupus familiaris, united states of america, saliva, mouth2016-12-05v4No1 / 91
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 91
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 91
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 92
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 93
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 94
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 95
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 95
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 97
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 97
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 99
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 99
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 99
766amnon high in age 2-7 years female organism adult organism compared to age 8 weeks puppy in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 102
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 102
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 104
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 105
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 105
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 106
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 107
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 107
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 108
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 108
691amnon high in spring compared to summer in commune of paris french republic water drinking water 2028-03-11v3No1 / 108
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 110
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 110
740amnoncommon marine iguana, amblyrhynchus cristatus, ecuador, galapagos islands, cloacal swab, alimentary part of gastrointestinal system, cloaca2021-02-08v4No1 / 110
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 111
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 112
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 113
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 113
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 113
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 115
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 116
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 116
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 118
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 119
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 120
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 122
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 123
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 123
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 124
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 125
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 126
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 126
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 126
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 128
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 129
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 132
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 133
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 133
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 133
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 135
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 136
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 138
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 139
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 139
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 140
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 141
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 145
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 146
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 147
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 149
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 149
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 153
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 153
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 154
26amnoncommon united states of america, felis catus, saliva, mouth2016-12-05v4No1 / 155
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth 25cm 2017-10-15v4No1 / 158
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 158
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 159
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 159
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-06v4No1 / 161
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 162
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 163
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 164
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 167
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 168
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 168
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 168
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 172
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 176
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 178
158amnoncommon cat, felis catus, united states of america, saliva, mouth2017-07-06v4No1 / 181
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 183
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 185
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 185
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 185
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 185
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 186
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 187
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 190
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 193
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 197
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 200
159amnoncommon siganidae, rabbitfish, hindgut, australia2017-07-06v4No1 / 200
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 202
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 202
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 205
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 205
360amnon high in summer compared to spring in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 206
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 207
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 219
545amnoncommon atlantic ocean, ocean, biofilm, debris, depth 200-2000 m2019-08-04v4No1 / 219
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 220
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 224
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 228
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 228
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 233
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 233
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 235
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 237
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 241
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 255
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 259
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 263
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 265
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 266
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 271
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 273
696amnon high in georissa georissa similis compared to alycaeus jagori in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 275
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 279
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 290
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 290
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 296
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 297
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 298
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 300
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 300
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 307
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 313
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 316
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 320
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 325
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 330
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 337
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 351
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 354
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 357
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v4No1 / 360
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 362
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 366
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 371
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 372
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 379
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 387
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 389
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 409
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 410
642amnon high in gill compared to alimentary part of gastrointestinal system gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 426
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 430
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 432
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 448
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 453
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 463
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 482
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
323amnoncommon water, atlantic ocean, south florida, state of florida, united states of america, surface water, depth 0cm, sea water2018-04-24v4No1 / 496
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 497
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 510
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 537
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 540
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 551
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 554
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 569
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v4No1 / 571
718amnon high in epilimnion compared to hypolimnion in meromictic lake "hells kitchen" lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 594
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 601
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 602
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 614
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 624
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 637
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 640
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 641
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 719
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 747
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 783
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 828
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 882
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 942
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1006
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1063
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1073
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1122
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1167
718amnon high in epilimnion compared to hypolimnion in "mary lake" ph 5.5-6 meromictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 1195
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1221
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1412
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1507
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1629
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1826
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2067
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2154
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2737
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3269
676amnon high in fish farm aquarium compared to water inlet in french republic sea water saline water english channel coastal waters of france 2028-02-27v4No1 / 3722
676amnon high in saline water sea water compared to saline water biofilm biofilm in aquarium fish farm french republic english channel coastal waters of france 2028-02-27v4No1 / 4343
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4845
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7946

Problems / suggestions? Please email info AT dbbact DOT org