Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGATGTGAAAACTGGGGGCTCAACCTCCAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG
common ontology terms
term enrichment score
TermScore
feces0.592855
homo sapiens0.581936
adult0.443864
united states of america0.246761
infant0.181818
child0.147937
china0.140221
control0.135659
female0.130587
germany0.110891
formula fed0.081633
city0.069045
2-5 year-old child stage0.065934
state of california0.065359
12-month-old human stage0.064516
kingdom of spain0.062500
italy0.059850
guangzhou city prefecture0.058968
research facility0.052672
taiwan0.052369
crohn's disease0.051471
obsolete_juvenile stage0.051471
caecum0.050955
canis lupus familiaris0.048555
LOWER IN control0.046729
ulcerative colitis0.044643
obesity0.043478
hospital0.043165
3-month-old human stage0.043011
age0.043011
dog0.042194
state of new york0.041667
jiangsu province0.039216
heterosexual0.037843
msw0.037843
clostridium difficile intestinal infectious disease0.037665
fourth decade human stage0.037665
republic of china0.037665
india0.037313
south korea0.036463
monkey0.036408
diarrhea0.035971
united kingdom0.035971
colon0.035842
LOWER IN male0.035842
LOWER IN adult0.035587
chicken0.035129
gallus gallus0.034924
australia0.031696
fifth decade human stage0.030380
LOWER IN rural community0.030303
age < 3 years0.030303
obese body mass index status0.030075
age 8 weeks0.030075
biopsy0.029925
human late adulthood stage0.029851
1-year-old human stage0.029777
state of colorado0.029630
kingdom of norway0.029197
japan0.028640
captive0.027397
c57bl/60.027211
canada0.026490
clostridium difficile infection0.022901
LOWER IN small village0.022901
terminal ileum0.022901
overweight body mass index status0.022857
state of oklahoma0.022857
parkinson's disease0.022814
municipality of logrono0.022727
hangzhou city prefecture0.022727
age 6-14 years0.022727
breast fed0.022727
oslo0.022727
zhengzhou city prefecture0.022727
age 7 months0.022727
state of ohio0.022727
LOWER IN 1-month-old human stage0.022727
indonesia0.022727
municipality of yogyakarta0.022727
rhesus macaque0.022727
age 3-60.022727
LOWER IN breast fed0.022472
state of michigan0.022472
colombia0.022472
hispanic or latin american0.022472
poland0.022472
rectum0.022388
finland0.022346
pregnancy0.022222
switzerland0.022222
taconic farms0.022222
LOWER IN jackson laboratories0.022222
hiv infection0.021978
macaca mulatta0.021739
sweden0.021622
high bmi0.021622
mouse0.021622
mus musculus0.020833
farm0.019231
Fraction of dbbact annotations with this term covered by the query
TermScore
heterosexual0.800000
msw0.800000
clostridium difficile infection0.750000
LOWER IN small village0.750000
fifth decade human stage0.750000
terminal ileum0.750000
taiwan0.750000
clostridium difficile intestinal infectious disease0.666667
LOWER IN rural community0.666667
age < 3 years0.666667
fourth decade human stage0.666667
sigmoid colon0.666667
republic of china0.666667
overweight body mass index status0.666667
young adult stage0.666667
state of oklahoma0.666667
2-5 year-old child stage0.600000
guangzhou city prefecture0.600000
parkinson's disease0.600000
ulcerative colitis0.555556
LOWER IN gastric bypass0.500000
human immunodeficiency virus infectious disease0.500000
antiretroviral therapy0.500000
municipality of logrono0.500000
LOWER IN bifidobacterium supplement0.500000
LOWER IN type 1 diabetes mellitus0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
valladolid0.500000
chronic fatigue syndrome0.500000
new york county0.500000
oslo0.500000
tucson0.500000
crohn's disease0.500000
LOWER IN autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
age 7 months0.500000
active disease0.500000
inflammatory bowel disease0.500000
acute severe colitis0.500000
state of ohio0.500000
meleagris gallopavo0.500000
wild turkey0.500000
LOWER IN 1-month-old human stage0.500000
age 14-28 days0.500000
stroke0.500000
indonesia0.500000
municipality of yogyakarta0.500000
before hsct0.500000
low fiber0.500000
LOWER IN mammalian milk beverage0.500000
LOWER IN age 2 months0.500000
children0.500000
type 1 diabetes mellitus0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
daycare0.500000
1-5-years-old human0.500000
autoimmune hepatitis0.500000
india0.500000
LOWER IN diarrhea0.500000
taoyuan city0.500000
graves' disease0.500000
eleventh decade human stage0.500000
centenarian human stage0.500000
human early adulthood stage0.500000
salmonella gastroenteritis0.500000
obese body mass index status0.500000
age 50-70 years0.500000
systemic lupus erythematosus0.500000
midwest region0.500000
state of louisiana0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
human adult stage0.500000
non-celiac gluten sensitivity0.500000
vegetarian diet0.500000
LOWER IN cron diet0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
schizophrenia0.500000
rhesus macaque0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
equine grass sickness0.500000
coronary heart disease0.500000
jordan0.500000
obsolete_juvenile stage0.500000
omnivore diet0.500000
free range chicken0.500000
age 4 days0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN 6-12 year-old child stage0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.930233
homo sapiens0.841085
adult0.457364
united states of america0.310078
china0.166667
control0.116279
infant0.116279
child0.093023
female0.085271
germany0.081395
research facility0.050388
formula fed0.046512
LOWER IN control0.038760
state of california0.038760
city0.038760
kingdom of spain0.034884
italy0.034884
2-5 year-old child stage0.034884
12-month-old human stage0.034884
guangzhou city prefecture0.031008
caecum0.031008
canis lupus familiaris0.027132
crohn's disease0.027132
taiwan0.027132
obsolete_juvenile stage0.027132
3-month-old human stage0.023256
dog0.023256
ulcerative colitis0.023256
hospital0.023256
age0.023256
state of new york0.023256
obesity0.023256
jiangsu province0.023256
clostridium difficile intestinal infectious disease0.019380
colon0.019380
diarrhea0.019380
LOWER IN adult0.019380
australia0.019380
gallus gallus0.019380
chicken0.019380
monkey0.019380
south korea0.019380
fourth decade human stage0.019380
united kingdom0.019380
india0.019380
republic of china0.019380
LOWER IN male0.019380
heterosexual0.019380
msw0.019380
LOWER IN rural community0.015504
biopsy0.015504
kingdom of norway0.015504
age < 3 years0.015504
fifth decade human stage0.015504
japan0.015504
1-year-old human stage0.015504
human late adulthood stage0.015504
obese body mass index status0.015504
captive0.015504
state of colorado0.015504
mus musculus0.015504
c57bl/60.015504
canada0.015504
mouse0.015504
age 8 weeks0.015504
hiv infection0.011628
municipality of logrono0.011628
clostridium difficile infection0.011628
hangzhou city prefecture0.011628
age 6-14 years0.011628
LOWER IN breast fed0.011628
LOWER IN small village0.011628
breast fed0.011628
state of michigan0.011628
oslo0.011628
zhengzhou city prefecture0.011628
finland0.011628
age 7 months0.011628
state of ohio0.011628
LOWER IN 1-month-old human stage0.011628
indonesia0.011628
municipality of yogyakarta0.011628
colombia0.011628
sweden0.011628
rectum0.011628
terminal ileum0.011628
parkinson's disease0.011628
high bmi0.011628
overweight body mass index status0.011628
pregnancy0.011628
macaca mulatta0.011628
rhesus macaque0.011628
state of oklahoma0.011628
farm0.011628
hispanic or latin american0.011628
switzerland0.011628
age 3-60.011628
poland0.011628
taconic farms0.011628
LOWER IN jackson laboratories0.011628
Exp. ID User ID Description Date Region Flag Sequences
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in feces homo sapiens united states of america )2017-10-23v4No1 / 5
794amnon high in hiv infection human immunodeficiency virus infectious disease antiretroviral therapy compared to control in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 5
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 5
797amnon high in control diet compared to bifidobacterium supplement in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 5
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
825amnon high in control compared to type i diabetes mellitus type 1 diabetes mellitus in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 7
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 10
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
409amnon high in left colon compared to right colon in homo sapiens united states of america colon biopsy site biopsy 2018-11-22v4No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
666amnondominant feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 18
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
720amnon high in control compared to autoimmune hepatitis in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
838amnondominant united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 27
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
127amnondominant united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 28
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 47
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
834amnoncommon feces, homo sapiens, adult, japan2021-09-11v1No1 / 50
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v4No1 / 51
127amnoncommon united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 51
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
847amnoncommon feces, japan, eleventh decade human stage, centenarian human stage2021-12-01v1No1 / 54
847amnoncommon feces, japan, human early adulthood stage2021-12-01v1No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
822amnon high in hydrolized diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
217amnoncommon feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
78amnonhigher in older gazelles ( high in age old age compared to young age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 273
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org