Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGTGCGCAGGCGGTTTGTTGAGTTTGAGGTGAAAGCGTTGGGCTTAACCCAATATAGCCTCAAATACTGGCAAACTAGAGTGCAGAAGAGGGAAACGGAACTCCATGT
common ontology terms
term enrichment score
TermScore
loxodonta africana0.666667
african elephant0.666667
state of tennessee0.333333
zoological garden0.181818
united states of america0.010000
feces0.008889
Fraction of dbbact annotations with this term covered by the query
TermScore
loxodonta africana0.500000
african elephant0.500000
state of tennessee0.200000
zoological garden0.100000
united states of america0.005025
feces0.004464
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
loxodonta africana1.000000
african elephant1.000000
zoological garden1.000000
state of tennessee1.000000

Problems / suggestions? Please email info AT dbbact DOT org