Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGTGCGCAGGCGGTTTGTTGAGTTTGAGGTGAAAGCGTTGGGCTTAACCCAATATAGCCTCAAATACTGGCAAACTAGAGTGCAGAAGAGGGAAACGGAACTCCATGT
common ontology terms
term enrichment score
TermScore
loxodonta africana0.666667
african elephant0.666667
zoological garden0.333333
state of tennessee0.333333
united states of america0.010870
feces0.010101
Fraction of dbbact annotations with this term covered by the query
TermScore
loxodonta africana0.500000
african elephant0.500000
zoological garden0.200000
state of tennessee0.200000
united states of america0.005464
feces0.005076
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
loxodonta africana1.000000
african elephant1.000000
zoological garden1.000000
state of tennessee1.000000

Problems / suggestions? Please email info AT dbbact DOT org