Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTCTGTCAAGTTAGCCGTGAAATTCCGGGGCTCAACTCCGGCGCTACGGCTAAGACTGACGGACTTGAGTGCAGGAGGGGCAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
dry forest0.333333
LOWER IN tropical moist broadleaf forest biome0.333333
alouatta palliata0.285714
mantled howler monkey0.285714
alouatta pigra0.200000
howler monkey0.200000
LOWER IN asian0.181818
caucasian0.166667
european0.166667
LOWER IN thailand0.142857
belgium0.125000
central america0.120000
low bmi0.117647
LOWER IN rural community0.105263
body mass index0.105263
state of florida0.101695
crohn's disease0.100000
state of new york0.100000
LOWER IN high bmi0.095238
united kingdom0.064516
LOWER IN male0.048780
feces0.037500
homo sapiens0.035842
female0.028169
united states of america0.023529
adult0.011050
LOWER IN control0.010363
Fraction of dbbact annotations with this term covered by the query
TermScore
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
alouatta pigra0.500000
howler monkey0.500000
alouatta palliata0.333333
mantled howler monkey0.333333
LOWER IN asian0.333333
caucasian0.250000
european0.250000
LOWER IN thailand0.166667
belgium0.125000
low bmi0.111111
LOWER IN rural community0.090909
body mass index0.090909
crohn's disease0.083333
state of new york0.083333
LOWER IN high bmi0.076923
central america0.071429
state of florida0.058824
united kingdom0.043478
LOWER IN male0.030303
feces0.019108
homo sapiens0.018450
female0.015873
united states of america0.012146
adult0.005780
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.625000
state of florida0.375000
central america0.375000
united states of america0.375000
dry forest0.250000
LOWER IN tropical moist broadleaf forest biome0.250000
alouatta palliata0.250000
mantled howler monkey0.250000
crohn's disease0.125000
LOWER IN control0.125000
belgium0.125000
alouatta pigra0.125000
howler monkey0.125000
LOWER IN thailand0.125000
LOWER IN rural community0.125000
body mass index0.125000
low bmi0.125000
LOWER IN high bmi0.125000
united kingdom0.125000
female0.125000
LOWER IN male0.125000
caucasian0.125000
european0.125000
LOWER IN asian0.125000
adult0.125000
state of new york0.125000

Problems / suggestions? Please email info AT dbbact DOT org