Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGCCAAGTCAGCTGTGAAAACTACAGGCTTAACTTGTAGACTGCAGTTGAAACTGGTTTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
gallus gallus0.285714
chicken0.285714
broiler chicken0.242424
canada0.214286
kingdom of spain0.200000
child0.171429
rural community0.169014
farm0.157895
age 2 weeks0.142857
taiwan0.137931
taipei city0.137931
peromyscus maniculatus0.137931
deer mice0.137931
age 3-5 weeks0.137931
province of ontario0.137931
algonquin provincial park0.137931
gallbladder0.137931
bile0.137931
cholelithiasis0.137931
chuquisaca department0.137931
captive0.129032
age 5-13 years0.129032
homo sapiens0.124060
bolivia0.121212
feces0.117055
caecum0.115942
LOWER IN adult0.095238
infant0.093023
age0.090909
obsolete_juvenile stage0.088889
LOWER IN free range chicken0.074074
toronto0.074074
age 15 - 35 days0.074074
low anterior resection0.074074
age 19-240.074074
LOWER IN age 30-500.074074
LOWER IN age 60-790.074074
LOWER IN age >940.074074
soldiers0.074074
age 1-20.074074
LOWER IN age 0-10.074074
toronto zoo0.074074
sewage0.074074
influent0.074074
LOWER IN effluent0.074074
sigmoid colon0.074074
children0.074074
age one year0.074074
LOWER IN age one month0.074074
LOWER IN arm0.074074
LOWER IN forearm0.074074
LOWER IN preweaned0.074074
LOWER IN suckling0.074074
LOWER IN age 2-4 weeks0.074074
weaned0.074074
age 4-7 weeks0.074074
corn and soybean diet0.074074
LOWER IN mouth mucosa0.074074
age 3 weeks0.071429
olive baboon0.071429
papio anubis0.071429
thailand0.071429
south america0.071429
terminal ileum0.071429
jiangxi province0.071429
wastewater treatment plant0.068966
age 4 weeks0.066667
egypt0.066667
biopsy0.066667
austria0.064516
india0.064516
kingdom of denmark0.064516
LOWER IN skin0.064516
adult0.063830
LOWER IN mouth0.062500
zoological garden0.060606
LOWER IN united states of america0.060606
united kingdom0.058824
rectum0.058824
LOWER IN crohn's disease0.058824
pig0.058824
sus scrofa0.058824
wild0.054054
china0.053571
city0.047619
colon0.045455
skin0.040000
control0.026846
united states of america0.018957
research facility0.016393
LOWER IN control0.013514
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
age 2 weeks0.666667
gallus gallus0.500000
chicken0.500000
broiler chicken0.500000
taiwan0.500000
taipei city0.500000
LOWER IN free range chicken0.500000
peromyscus maniculatus0.500000
deer mice0.500000
age 3-5 weeks0.500000
province of ontario0.500000
algonquin provincial park0.500000
toronto0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
age 15 - 35 days0.500000
low anterior resection0.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 1-20.500000
LOWER IN age 0-10.500000
toronto zoo0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN mouth mucosa0.500000
age 3 weeks0.333333
captive0.333333
olive baboon0.333333
papio anubis0.333333
thailand0.333333
south america0.333333
terminal ileum0.333333
age 5-13 years0.333333
jiangxi province0.333333
rural community0.285714
wastewater treatment plant0.250000
bolivia0.250000
kingdom of spain0.200000
age 4 weeks0.200000
egypt0.200000
biopsy0.200000
austria0.166667
india0.166667
kingdom of denmark0.166667
LOWER IN skin0.166667
child0.150000
LOWER IN mouth0.142857
farm0.130435
zoological garden0.125000
LOWER IN united states of america0.125000
LOWER IN adult0.117647
united kingdom0.111111
infant0.111111
rectum0.111111
LOWER IN crohn's disease0.111111
pig0.111111
sus scrofa0.111111
age0.105263
obsolete_juvenile stage0.100000
caecum0.090909
wild0.083333
homo sapiens0.069182
feces0.064039
city0.058824
colon0.052632
skin0.040000
adult0.037975
china0.034483
control0.016129
united states of america0.010753
research facility0.010309
LOWER IN control0.008130
Fraction of annotations for the query sequences containing the term
TermScore
feces0.680000
homo sapiens0.600000
gallus gallus0.200000
chicken0.200000
kingdom of spain0.200000
farm0.200000
adult0.200000
child0.200000
caecum0.160000
broiler chicken0.160000
canada0.120000
china0.120000
rural community0.120000
age 2 weeks0.080000
taiwan0.080000
taipei city0.080000
control0.080000
peromyscus maniculatus0.080000
deer mice0.080000
age 3-5 weeks0.080000
province of ontario0.080000
algonquin provincial park0.080000
captive0.080000
LOWER IN adult0.080000
gallbladder0.080000
bile0.080000
cholelithiasis0.080000
infant0.080000
age0.080000
united states of america0.080000
obsolete_juvenile stage0.080000
age 5-13 years0.080000
bolivia0.080000
chuquisaca department0.080000
austria0.040000
LOWER IN free range chicken0.040000
age 3 weeks0.040000
research facility0.040000
toronto0.040000
LOWER IN control0.040000
age 15 - 35 days0.040000
united kingdom0.040000
wild0.040000
low anterior resection0.040000
age 4 weeks0.040000
age 19-240.040000
LOWER IN age 30-500.040000
LOWER IN age 60-790.040000
LOWER IN age >940.040000
soldiers0.040000
age 1-20.040000
LOWER IN age 0-10.040000
india0.040000
toronto zoo0.040000
zoological garden0.040000
olive baboon0.040000
papio anubis0.040000
skin0.040000
thailand0.040000
LOWER IN united states of america0.040000
egypt0.040000
south america0.040000
wastewater treatment plant0.040000
sewage0.040000
influent0.040000
LOWER IN effluent0.040000
city0.040000
rectum0.040000
terminal ileum0.040000
sigmoid colon0.040000
colon0.040000
biopsy0.040000
children0.040000
LOWER IN crohn's disease0.040000
kingdom of denmark0.040000
age one year0.040000
LOWER IN age one month0.040000
LOWER IN skin0.040000
LOWER IN arm0.040000
LOWER IN forearm0.040000
pig0.040000
sus scrofa0.040000
jiangxi province0.040000
LOWER IN preweaned0.040000
LOWER IN suckling0.040000
LOWER IN age 2-4 weeks0.040000
weaned0.040000
age 4-7 weeks0.040000
corn and soybean diet0.040000
LOWER IN mouth mucosa0.040000
LOWER IN mouth0.040000
Exp. ID User ID Description Date Region Flag Sequences
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
495amnon high in broiler chicken compared to free range chicken in gallus gallus chicken caecum kingdom of spain farm age 3 weeks 2019-03-03v4No1 / 90
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org