Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGCCAAGTCAGCTGTGAAAACTACAGGCTTAACTTGTAGACTGCAGTTGAAACTGGTTTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCGAG
common ontology terms
term enrichment score
TermScore
gallus gallus0.319149
chicken0.319149
broiler chicken0.275862
kingdom of spain0.208333
child0.194805
rural community0.179104
farm0.167598
age 2 weeks0.153846
taipei city0.148148
taiwan0.148148
algonquin provincial park0.148148
province of ontario0.148148
age 3-5 weeks0.148148
deer mice0.148148
peromyscus maniculatus0.148148
cholelithiasis0.148148
bile0.148148
gallbladder0.148148
chuquisaca department0.148148
age 5-13 years0.148148
bolivia0.129032
caecum0.123077
homo sapiens0.120172
feces0.113074
LOWER IN adult0.100000
infant0.097561
age0.095238
obsolete_juvenile stage0.093023
LOWER IN free range chicken0.080000
toronto0.080000
age 15 - 35 days0.080000
low anterior resection0.080000
age 19-240.080000
LOWER IN age 30-500.080000
LOWER IN age 60-790.080000
LOWER IN age >940.080000
soldiers0.080000
age 1-20.080000
LOWER IN age 0-10.080000
thailand0.080000
sewage0.080000
influent0.080000
LOWER IN effluent0.080000
sigmoid colon0.080000
children0.080000
age one year0.080000
LOWER IN age one month0.080000
LOWER IN forearm0.080000
LOWER IN arm0.080000
corn and soybean diet0.080000
age 4-7 weeks0.080000
weaned0.080000
LOWER IN age 2-4 weeks0.080000
LOWER IN suckling0.080000
LOWER IN preweaned0.080000
LOWER IN mouth mucosa0.080000
canada0.078431
age 3 weeks0.076923
captive0.076923
egypt0.076923
south america0.076923
terminal ileum0.076923
jiangxi province0.076923
wastewater treatment plant0.074074
age 4 weeks0.071429
biopsy0.071429
austria0.068966
india0.068966
kingdom of denmark0.068966
LOWER IN skin0.068966
LOWER IN mouth0.066667
LOWER IN united states of america0.064516
united kingdom0.062500
rectum0.062500
LOWER IN crohn's disease0.062500
sus scrofa0.062500
pig0.062500
wild0.058824
city0.051282
colon0.048780
adult0.046784
china0.037383
control0.028369
united states of america0.019608
research facility0.016667
LOWER IN control0.014286
Fraction of dbbact annotations with this term covered by the query
TermScore
broiler chicken0.666667
age 2 weeks0.666667
gallus gallus0.600000
chicken0.600000
taipei city0.500000
taiwan0.500000
LOWER IN free range chicken0.500000
algonquin provincial park0.500000
province of ontario0.500000
age 3-5 weeks0.500000
deer mice0.500000
peromyscus maniculatus0.500000
toronto0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
age 15 - 35 days0.500000
low anterior resection0.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 1-20.500000
LOWER IN age 0-10.500000
thailand0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN mouth mucosa0.500000
age 3 weeks0.333333
captive0.333333
egypt0.333333
south america0.333333
terminal ileum0.333333
jiangxi province0.333333
rural community0.285714
wastewater treatment plant0.250000
bolivia0.250000
kingdom of spain0.200000
age 4 weeks0.200000
biopsy0.200000
child0.176471
austria0.166667
india0.166667
kingdom of denmark0.166667
LOWER IN skin0.166667
LOWER IN mouth0.142857
farm0.136364
LOWER IN united states of america0.125000
LOWER IN adult0.117647
united kingdom0.111111
infant0.111111
rectum0.111111
LOWER IN crohn's disease0.111111
sus scrofa0.111111
pig0.111111
age0.105263
obsolete_juvenile stage0.100000
caecum0.095238
wild0.090909
canada0.071429
homo sapiens0.066667
city0.062500
feces0.061538
colon0.055556
adult0.027027
china0.023810
control0.016949
united states of america0.011050
research facility0.010309
LOWER IN control0.008547
Fraction of annotations for the query sequences containing the term
TermScore
feces0.695652
homo sapiens0.608696
gallus gallus0.217391
chicken0.217391
kingdom of spain0.217391
farm0.217391
child0.217391
caecum0.173913
broiler chicken0.173913
adult0.173913
rural community0.130435
age 2 weeks0.086957
control0.086957
taipei city0.086957
taiwan0.086957
algonquin provincial park0.086957
province of ontario0.086957
age 3-5 weeks0.086957
deer mice0.086957
peromyscus maniculatus0.086957
canada0.086957
LOWER IN adult0.086957
cholelithiasis0.086957
bile0.086957
gallbladder0.086957
china0.086957
infant0.086957
age0.086957
united states of america0.086957
obsolete_juvenile stage0.086957
chuquisaca department0.086957
bolivia0.086957
age 5-13 years0.086957
austria0.043478
LOWER IN free range chicken0.043478
age 3 weeks0.043478
captive0.043478
research facility0.043478
toronto0.043478
LOWER IN control0.043478
united kingdom0.043478
age 15 - 35 days0.043478
wild0.043478
low anterior resection0.043478
age 4 weeks0.043478
age 19-240.043478
LOWER IN age 30-500.043478
LOWER IN age 60-790.043478
LOWER IN age >940.043478
soldiers0.043478
india0.043478
age 1-20.043478
LOWER IN age 0-10.043478
thailand0.043478
LOWER IN united states of america0.043478
egypt0.043478
south america0.043478
wastewater treatment plant0.043478
sewage0.043478
influent0.043478
LOWER IN effluent0.043478
city0.043478
rectum0.043478
terminal ileum0.043478
sigmoid colon0.043478
colon0.043478
biopsy0.043478
children0.043478
LOWER IN crohn's disease0.043478
kingdom of denmark0.043478
age one year0.043478
LOWER IN age one month0.043478
LOWER IN forearm0.043478
LOWER IN arm0.043478
LOWER IN skin0.043478
corn and soybean diet0.043478
age 4-7 weeks0.043478
weaned0.043478
LOWER IN age 2-4 weeks0.043478
LOWER IN suckling0.043478
LOWER IN preweaned0.043478
jiangxi province0.043478
sus scrofa0.043478
pig0.043478
LOWER IN mouth mucosa0.043478
LOWER IN mouth0.043478
Exp. ID User ID Description Date Region Flag Sequences
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 28
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
495amnon high in broiler chicken compared to free range chicken in gallus gallus chicken caecum kingdom of spain farm age 3 weeks 2019-03-03v4No1 / 90
537amnoncommon in feces of captive grown deer mice feces (common captive, research facility, algonquin provincial park, province of ontario, age 3-5 weeks, deer mice, peromyscus maniculatus, canada, feces)2019-07-28v3No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
526amnon high in cholelithiasis compared to control in kingdom of spain adult bile gallbladder homo sapiens 2019-07-14v3No1 / 131
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
379amnoncommon gallus gallus, chicken, feces, united kingdom, age 15 - 35 days2018-09-14v4No1 / 160
537amnoncommon in feces of wild caught deer mice feces (common wild, algonquin provincial park, province of ontario, age 3-5 weeks, deer mice, peromyscus maniculatus, canada, feces)2019-07-28v3No1 / 163
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 4 weeks2019-03-03v4No1 / 185
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org