Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAGACAAGTTGGGAGTGAAATGTATGGGCTTAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
low anterior resection0.500000
taipei city0.500000
taiwan0.500000
LOWER IN plant diet0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
constipation0.500000
LOWER IN short bowel syndrome0.500000
tnbs0.500000
cron diet0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rattus norvegicus0.428571
sprague dawley0.428571
animal product diet0.333333
rat0.333333
medellin metropolitan area0.333333
caloric restriction diet0.333333
LOWER IN american diet0.333333
LOWER IN small village0.250000
colombia0.200000
czech republic0.200000
body mass index0.200000
colitis0.200000
city0.187500
low bmi0.166667
rattus0.166667
LOWER IN child0.166667
LOWER IN ulcerative colitis0.142857
LOWER IN high bmi0.142857
united kingdom0.111111
LOWER IN crohn's disease0.111111
diet0.086957
adult0.067568
feces0.066667
homo sapiens0.066667
male0.052632
china0.047619
research facility0.041237
united states of america0.022099
control0.016949
LOWER IN control0.008547
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.722222
china0.388889
united states of america0.333333
adult0.277778
research facility0.277778
rat0.277778
rattus norvegicus0.222222
sprague dawley0.222222
control0.166667
city0.166667
diet0.111111
male0.111111
age >940.111111
age 30-500.111111
age 60-790.111111
LOWER IN control0.055556
low anterior resection0.055556
taipei city0.055556
taiwan0.055556
animal product diet0.055556
LOWER IN plant diet0.055556
LOWER IN ulcerative colitis0.055556
shantytown0.055556
lima0.055556
LOWER IN el salado0.055556
LOWER IN small village0.055556
colombia0.055556
medellin metropolitan area0.055556
bogota0.055556
LOWER IN municipality of santiago de cali0.055556
LOWER IN bucaramanga0.055556
LOWER IN barranquilla0.055556
constipation0.055556
LOWER IN short bowel syndrome0.055556
czech republic0.055556
united kingdom0.055556
body mass index0.055556
low bmi0.055556
LOWER IN high bmi0.055556
colitis0.055556
tnbs0.055556
cron diet0.055556
caloric restriction diet0.055556
LOWER IN american diet0.055556
LOWER IN crohn's disease0.055556
LOWER IN amerindian0.055556
LOWER IN hunter gatherer0.055556
LOWER IN venezuela0.055556
rattus0.055556
LOWER IN age 30-500.055556
LOWER IN age 60-790.055556
LOWER IN age 3-60.055556
LOWER IN age 8-120.055556
LOWER IN child0.055556
LOWER IN age 19-240.055556
LOWER IN soldiers0.055556
Exp. ID User ID Description Date Region Flag Sequences
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in adult taipei city taiwan feces homo sapiens )2019-07-18v3No1 / 115
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, china, research facility, feces, constipation)2018-12-02v4No1 / 300
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, china, feces, colitis, tnbs)2019-01-06v4No1 / 360
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, china, feces2019-01-06v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
221amnoncommon rattus, sprague dawley, rat, feces, china, research facility2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org