Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAGACAAGTTGGGAGTGAAATGTATGGGCTTAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
rat0.277778
rattus norvegicus0.263736
sprague dawley0.263736
broiler chicken0.181818
male0.160000
age >940.160000
age 30-500.160000
age 60-790.160000
city0.157895
chicken0.153846
gallus gallus0.153846
thailand0.148148
feces0.129032
homo sapiens0.114185
adult0.100000
diet0.088889
taiwan0.086957
taipei city0.086957
low anterior resection0.086957
LOWER IN plant diet0.086957
LOWER IN viet nam0.086957
shantytown0.086957
lima0.086957
LOWER IN el salado0.086957
bogota0.086957
LOWER IN municipality of santiago de cali0.086957
LOWER IN bucaramanga0.086957
LOWER IN barranquilla0.086957
viet nam0.086957
constipation0.086957
LOWER IN short bowel syndrome0.086957
tnbs0.086957
cron diet0.086957
LOWER IN amerindian0.086957
LOWER IN hunter gatherer0.086957
LOWER IN venezuela0.086957
LOWER IN age 30-500.086957
LOWER IN age 60-790.086957
LOWER IN age 3-60.086957
LOWER IN age 8-120.086957
LOWER IN age 19-240.086957
LOWER IN soldiers0.086957
animal product diet0.083333
medellin metropolitan area0.083333
caloric restriction diet0.083333
LOWER IN american diet0.083333
china0.080808
LOWER IN small village0.080000
colombia0.076923
body mass index0.076923
colitis0.076923
czech republic0.074074
low bmi0.074074
rattus0.074074
LOWER IN child0.074074
LOWER IN ulcerative colitis0.071429
LOWER IN high bmi0.071429
research facility0.070299
united kingdom0.066667
LOWER IN crohn's disease0.066667
united states of america0.040000
control0.028986
LOWER IN control0.013889
Fraction of dbbact annotations with this term covered by the query
TermScore
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
LOWER IN plant diet0.500000
LOWER IN viet nam0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
viet nam0.500000
constipation0.500000
LOWER IN short bowel syndrome0.500000
male0.500000
tnbs0.500000
cron diet0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rattus norvegicus0.428571
sprague dawley0.428571
animal product diet0.333333
rat0.333333
thailand0.333333
medellin metropolitan area0.333333
caloric restriction diet0.333333
LOWER IN american diet0.333333
broiler chicken0.250000
LOWER IN small village0.250000
colombia0.200000
body mass index0.200000
colitis0.200000
city0.176471
chicken0.166667
gallus gallus0.166667
czech republic0.166667
low bmi0.166667
rattus0.166667
LOWER IN child0.166667
LOWER IN ulcerative colitis0.142857
LOWER IN high bmi0.142857
united kingdom0.111111
LOWER IN crohn's disease0.111111
diet0.083333
feces0.068966
adult0.063291
homo sapiens0.062893
china0.045977
research facility0.041237
united states of america0.021505
control0.016129
LOWER IN control0.008130
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.619048
china0.333333
united states of america0.285714
adult0.238095
research facility0.238095
rat0.238095
rattus norvegicus0.190476
sprague dawley0.190476
control0.142857
broiler chicken0.142857
chicken0.142857
gallus gallus0.142857
city0.142857
diet0.095238
thailand0.095238
male0.095238
age >940.095238
age 30-500.095238
age 60-790.095238
taiwan0.047619
taipei city0.047619
low anterior resection0.047619
LOWER IN control0.047619
animal product diet0.047619
LOWER IN plant diet0.047619
LOWER IN ulcerative colitis0.047619
LOWER IN viet nam0.047619
shantytown0.047619
lima0.047619
LOWER IN el salado0.047619
LOWER IN small village0.047619
colombia0.047619
medellin metropolitan area0.047619
bogota0.047619
LOWER IN municipality of santiago de cali0.047619
LOWER IN bucaramanga0.047619
LOWER IN barranquilla0.047619
viet nam0.047619
constipation0.047619
czech republic0.047619
LOWER IN short bowel syndrome0.047619
body mass index0.047619
low bmi0.047619
LOWER IN high bmi0.047619
united kingdom0.047619
tnbs0.047619
colitis0.047619
cron diet0.047619
caloric restriction diet0.047619
LOWER IN american diet0.047619
LOWER IN crohn's disease0.047619
LOWER IN amerindian0.047619
LOWER IN hunter gatherer0.047619
LOWER IN venezuela0.047619
rattus0.047619
LOWER IN age 30-500.047619
LOWER IN age 60-790.047619
LOWER IN age 3-60.047619
LOWER IN age 8-120.047619
LOWER IN child0.047619
LOWER IN age 19-240.047619
LOWER IN soldiers0.047619
Exp. ID User ID Description Date Region Flag Sequences
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
568amnon high in thailand compared to viet nam in broiler chicken feces chicken gallus gallus 2019-12-08v3No1 / 206
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
568amnoncommon viet nam, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 272
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
568amnoncommon thailand, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 320
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org