Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATACAAGTTGAATGTTAAAACTATGGGCTCAACCCATAGTTGCGTTCAAAACTGTATTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
LOWER IN united states of america0.363636
rural community0.342857
child0.240000
africa0.222222
age 5-13 years0.222222
chuquisaca department0.222222
bolivia0.181818
egypt0.166667
himalayas0.125000
low income0.125000
LOWER IN sewer0.125000
LOWER IN wastewater treatment plant0.125000
bangladesh0.125000
thailand0.125000
age 30-500.125000
age 60-790.125000
LOWER IN age 3-60.125000
LOWER IN age 8-120.125000
central african republic0.125000
LOWER IN madagascar0.125000
bangui0.125000
LOWER IN antananarivo0.125000
LOWER IN arm0.125000
LOWER IN forearm0.125000
LOWER IN preweaned0.125000
LOWER IN suckling0.125000
LOWER IN age 2-4 weeks0.125000
weaned0.125000
age 4-7 weeks0.125000
corn and soybean diet0.125000
LOWER IN mouth mucosa0.125000
homo sapiens0.120650
nepal0.117647
obsolete_juvenile stage0.117647
south america0.117647
amerindian0.117647
venezuela0.117647
jiangxi province0.117647
LOWER IN diarrhea0.111111
hunter gatherer0.111111
LOWER IN age < 1 year0.111111
feces0.105769
LOWER IN infant0.105263
LOWER IN city0.100000
india0.100000
LOWER IN child0.100000
LOWER IN skin0.100000
LOWER IN mouth0.095238
LOWER IN duodenum0.090909
adult0.087912
pig0.086957
sus scrofa0.086957
city0.064516
farm0.055556
china0.040404
control0.014925
Fraction of dbbact annotations with this term covered by the query
TermScore
himalayas0.500000
LOWER IN united states of america0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
bangladesh0.500000
thailand0.500000
africa0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
age 5-13 years0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN mouth mucosa0.500000
rural community0.428571
nepal0.333333
south america0.333333
amerindian0.333333
venezuela0.333333
jiangxi province0.333333
LOWER IN diarrhea0.250000
hunter gatherer0.250000
LOWER IN age < 1 year0.250000
bolivia0.250000
egypt0.200000
LOWER IN infant0.200000
child0.166667
LOWER IN city0.166667
india0.166667
LOWER IN child0.166667
LOWER IN skin0.166667
LOWER IN mouth0.142857
LOWER IN duodenum0.125000
pig0.111111
sus scrofa0.111111
obsolete_juvenile stage0.100000
homo sapiens0.064516
city0.058824
feces0.055838
adult0.051948
farm0.045455
china0.023529
control0.008333
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.928571
child0.428571
adult0.285714
rural community0.285714
LOWER IN united states of america0.285714
egypt0.142857
obsolete_juvenile stage0.142857
africa0.142857
china0.142857
age 5-13 years0.142857
bolivia0.142857
chuquisaca department0.142857
nepal0.071429
himalayas0.071429
south america0.071429
city0.071429
low income0.071429
LOWER IN sewer0.071429
LOWER IN wastewater treatment plant0.071429
bangladesh0.071429
control0.071429
LOWER IN diarrhea0.071429
thailand0.071429
LOWER IN duodenum0.071429
hunter gatherer0.071429
amerindian0.071429
venezuela0.071429
LOWER IN city0.071429
LOWER IN infant0.071429
LOWER IN age < 1 year0.071429
india0.071429
age 30-500.071429
age 60-790.071429
LOWER IN age 3-60.071429
LOWER IN age 8-120.071429
LOWER IN child0.071429
central african republic0.071429
LOWER IN madagascar0.071429
bangui0.071429
LOWER IN antananarivo0.071429
LOWER IN skin0.071429
LOWER IN arm0.071429
LOWER IN forearm0.071429
pig0.071429
sus scrofa0.071429
farm0.071429
jiangxi province0.071429
LOWER IN preweaned0.071429
LOWER IN suckling0.071429
LOWER IN age 2-4 weeks0.071429
weaned0.071429
age 4-7 weeks0.071429
corn and soybean diet0.071429
LOWER IN mouth mucosa0.071429
LOWER IN mouth0.071429
Exp. ID User ID Description Date Region Flag Sequences
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org