Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATACAAGTTGAATGTTAAAACTATGGGCTCAACCCATAGTTGCGTTCAAAACTGTATTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
LOWER IN united states of america0.320000
rural community0.285714
chuquisaca department0.200000
child0.193548
africa0.181818
age 5-13 years0.181818
bolivia0.166667
egypt0.153846
homo sapiens0.125786
city0.117647
obsolete_juvenile stage0.111111
himalayas0.111111
cameroon0.111111
yaounde0.111111
low income0.111111
LOWER IN sewer0.111111
LOWER IN wastewater treatment plant0.111111
bangladesh0.111111
age 30-500.111111
age 60-790.111111
LOWER IN age 3-60.111111
LOWER IN age 8-120.111111
central african republic0.111111
LOWER IN madagascar0.111111
bangui0.111111
LOWER IN antananarivo0.111111
LOWER IN arm0.111111
LOWER IN forearm0.111111
LOWER IN preweaned0.111111
LOWER IN suckling0.111111
LOWER IN age 2-4 weeks0.111111
weaned0.111111
age 4-7 weeks0.111111
corn and soybean diet0.111111
feces0.109705
adult0.109091
nepal0.105263
south america0.105263
thailand0.105263
amerindian0.105263
venezuela0.105263
jiangxi province0.105263
LOWER IN mouth mucosa0.105263
LOWER IN diarrhea0.100000
hunter gatherer0.100000
gay0.100000
LOWER IN msw0.100000
LOWER IN heterosexual0.100000
LOWER IN infant0.095238
LOWER IN age < 1 year0.095238
homosexual0.095238
msm0.095238
LOWER IN skin0.090909
LOWER IN city0.086957
india0.086957
LOWER IN child0.086957
LOWER IN mouth0.086957
LOWER IN duodenum0.083333
hiv infection0.083333
male0.080000
pig0.080000
sus scrofa0.080000
sweden0.076923
kingdom of spain0.071429
farm0.045455
china0.033058
control0.012903
Fraction of dbbact annotations with this term covered by the query
TermScore
himalayas0.500000
cameroon0.500000
yaounde0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
bangladesh0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN united states of america0.444444
nepal0.333333
rural community0.333333
south america0.333333
thailand0.333333
africa0.333333
amerindian0.333333
venezuela0.333333
age 5-13 years0.333333
jiangxi province0.333333
LOWER IN mouth mucosa0.333333
LOWER IN diarrhea0.250000
hunter gatherer0.250000
gay0.250000
LOWER IN msw0.250000
LOWER IN heterosexual0.250000
bolivia0.250000
egypt0.200000
LOWER IN infant0.200000
LOWER IN age < 1 year0.200000
homosexual0.200000
msm0.200000
LOWER IN skin0.166667
LOWER IN city0.142857
india0.142857
LOWER IN child0.142857
LOWER IN mouth0.142857
child0.130435
LOWER IN duodenum0.125000
hiv infection0.125000
city0.111111
male0.111111
pig0.111111
sus scrofa0.111111
obsolete_juvenile stage0.100000
sweden0.100000
kingdom of spain0.083333
homo sapiens0.067416
adult0.063830
feces0.058036
farm0.035714
china0.019048
control0.007194
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.937500
adult0.375000
child0.375000
rural community0.250000
LOWER IN united states of america0.250000
egypt0.125000
obsolete_juvenile stage0.125000
city0.125000
africa0.125000
china0.125000
age 5-13 years0.125000
bolivia0.125000
chuquisaca department0.125000
nepal0.062500
himalayas0.062500
cameroon0.062500
yaounde0.062500
south america0.062500
low income0.062500
LOWER IN sewer0.062500
LOWER IN wastewater treatment plant0.062500
bangladesh0.062500
control0.062500
LOWER IN diarrhea0.062500
thailand0.062500
LOWER IN duodenum0.062500
hunter gatherer0.062500
amerindian0.062500
venezuela0.062500
LOWER IN city0.062500
LOWER IN infant0.062500
LOWER IN age < 1 year0.062500
india0.062500
age 30-500.062500
age 60-790.062500
LOWER IN age 3-60.062500
LOWER IN age 8-120.062500
LOWER IN child0.062500
hiv infection0.062500
kingdom of spain0.062500
sweden0.062500
male0.062500
homosexual0.062500
msm0.062500
gay0.062500
LOWER IN msw0.062500
LOWER IN heterosexual0.062500
central african republic0.062500
LOWER IN madagascar0.062500
bangui0.062500
LOWER IN antananarivo0.062500
LOWER IN skin0.062500
LOWER IN arm0.062500
LOWER IN forearm0.062500
pig0.062500
sus scrofa0.062500
farm0.062500
jiangxi province0.062500
LOWER IN preweaned0.062500
LOWER IN suckling0.062500
LOWER IN age 2-4 weeks0.062500
weaned0.062500
age 4-7 weeks0.062500
corn and soybean diet0.062500
LOWER IN mouth mucosa0.062500
LOWER IN mouth0.062500
Exp. ID User ID Description Date Region Flag Sequences
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org