Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.723844
adult0.446895
saliva0.362641
feces0.298827
child0.287621
infant0.220582
united states of america0.187541
china0.154969
state of new york0.108434
female0.090428
germany0.089552
oral cavity0.083507
sweden0.081582
mouth mucosa0.081122
tongue0.076923
mouth0.069215
oral wash0.068611
control0.067976
hospital0.063291
lung0.060345
obsolete_juvenile stage0.059914
dentition0.057821
australia0.057377
dermal layer of tongue0.056491
city0.054247
formula fed0.051948
age 3 months0.051613
municipality of umea0.051282
czech republic0.050847
skin0.050436
africa0.048780
buccal mucosa0.048061
rural community0.047585
poland0.047210
south korea0.047025
state of california0.044444
sputum0.039539
hunter gatherer0.039474
LOWER IN dentition0.039400
LOWER IN control0.039088
supragingival plaque0.038585
diarrhea0.038462
municipality of beijing0.038217
kingdom of denmark0.037500
periodontitis0.036145
bronchial epithelium0.035242
palatine tonsil0.035242
subgingival dental plaque0.034985
bronchoalveolar lavage0.034934
age 1 year0.034783
bolivia0.034783
subgingival plaque0.033241
venezuela0.030803
amerindian0.030803
age < 3 years0.030803
india0.030568
state of michigan0.030108
italy0.029443
LOWER IN supragingival plaque0.026525
age 5-10 years0.026490
type 2 diabetes mellitus0.026316
finland0.026201
sichuan province0.026087
commonwealth of pennsylvania0.025974
supragingival dental plaque0.025806
LOWER IN adult0.025445
pair of nares0.025424
duodenum0.025157
tanzania0.022189
small village0.022189
chronic periodontitis0.022148
colombia0.022148
age 7 years0.022148
mild disease course0.022026
state of new hampshire0.022026
bangui0.022026
antananarivo0.022026
late adult stage0.022026
city of dresden0.022026
stunted growth0.022026
age < 1 year0.021946
nasopharynx0.021906
central african republic0.021786
madagascar0.021786
ulcerative colitis0.021786
pregnancy0.021786
mucus0.021668
nasal cavity0.021629
cystic fibrosis0.021322
age0.021265
canada0.020141
research facility0.019493
bronchus0.017778
tonsillitis0.017778
LOWER IN breast fed0.017778
toronto0.017778
LOWER IN supragingival dental plaque0.017751
trachea0.017699
acute respiratory failure0.017699
age 6 months0.017699
Fraction of dbbact annotations with this term covered by the query
TermScore
saliva0.860465
sputum0.800000
buccal mucosa0.800000
bronchial epithelium0.800000
dermal layer of tongue0.800000
palatine tonsil0.800000
mouth mucosa0.777778
child0.750000
tanzania0.750000
hunter gatherer0.750000
tongue0.750000
small village0.750000
oral wash0.714286
LOWER IN supragingival plaque0.714286
infant0.708333
lung0.700000
LOWER IN dentition0.700000
LOWER IN mouth neoplasm0.666667
LOWER IN cancer0.666667
age 5-10 years0.666667
chronic periodontitis0.666667
bronchus0.666667
venezuela0.666667
amerindian0.666667
formula fed0.666667
colombia0.666667
tonsillitis0.666667
age < 3 years0.666667
pancreatic cancer0.666667
LOWER IN breast fed0.666667
atlanta0.666667
age 2-4 years0.666667
age 7 years0.666667
hispanic or latin american0.666667
arm0.666667
toronto0.666667
asian0.666667
subgingival dental plaque0.600000
obsolete_juvenile stage0.600000
rural community0.600000
LOWER IN supragingival dental plaque0.600000
homo sapiens0.586207
oral cavity0.571429
bronchoalveolar lavage0.571429
age 3 months0.571429
LOWER IN neoplasm0.500000
mild disease course0.500000
state of new hampshire0.500000
poland0.500000
state of new york0.500000
hospital0.500000
age 1 year0.500000
protected brush sampling0.500000
induced sputum0.500000
municipality of umea0.500000
breast milk0.500000
hypopharynx0.500000
trachea0.500000
endotracheal aspirate0.500000
acute respiratory failure0.500000
idiopathic pulmonary fibrosis0.500000
lower labial mucosa0.500000
age 6 months0.500000
acute pericementitis0.500000
middle nasal meatus0.500000
nose0.500000
bronchial brush0.500000
bangui0.500000
antananarivo0.500000
squamous esophagus0.500000
esophagus0.500000
cornell university0.500000
breast fed0.500000
dorsum of tongue0.500000
age one month0.500000
inflammatory bowel disease0.500000
LOWER IN doxycycline0.500000
LOWER IN amoxicillin0.500000
before antibiotics0.500000
acute severe colitis0.500000
late adult stage0.500000
age 13-15 years0.500000
bolivia0.500000
mallard0.500000
gastric bypass0.500000
nigeria0.500000
oropharynx0.500000
oropharyngeal swab0.500000
jinan city prefecture0.500000
severe0.500000
LOWER IN mild0.500000
oesophageal brush0.500000
age 7-14 years0.500000
chronic bad breath0.500000
halitosis0.500000
age 18 months0.500000
hard palate0.500000
short bowel syndrome0.500000
oslo0.500000
LOWER IN age 30-400.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.945946
adult0.436937
feces0.362613
saliva0.229730
united states of america0.222973
child0.177928
china0.162162
infant0.130631
state of new york0.060811
female0.056306
germany0.054054
control0.051802
sweden0.049550
oral cavity0.045045
mouth mucosa0.042793
tongue0.040541
mouth0.038288
oral wash0.036036
hospital0.033784
lung0.031532
obsolete_juvenile stage0.031532
dentition0.031532
australia0.031532
city0.029279
dermal layer of tongue0.029279
skin0.029279
age 3 months0.027027
municipality of umea0.027027
czech republic0.027027
africa0.027027
formula fed0.027027
LOWER IN control0.027027
state of california0.027027
poland0.024775
south korea0.024775
buccal mucosa0.024775
rural community0.024775
diarrhea0.020270
sputum0.020270
kingdom of denmark0.020270
periodontitis0.020270
municipality of beijing0.020270
hunter gatherer0.020270
supragingival plaque0.020270
LOWER IN dentition0.020270
bronchoalveolar lavage0.018018
age 1 year0.018018
subgingival plaque0.018018
subgingival dental plaque0.018018
bronchial epithelium0.018018
bolivia0.018018
palatine tonsil0.018018
state of michigan0.015766
venezuela0.015766
amerindian0.015766
italy0.015766
india0.015766
age < 3 years0.015766
age 5-10 years0.013514
commonwealth of pennsylvania0.013514
sichuan province0.013514
LOWER IN adult0.013514
supragingival dental plaque0.013514
pair of nares0.013514
type 2 diabetes mellitus0.013514
finland0.013514
duodenum0.013514
LOWER IN supragingival plaque0.013514
research facility0.013514
mucus0.011261
mild disease course0.011261
cystic fibrosis0.011261
state of new hampshire0.011261
age < 1 year0.011261
nasal cavity0.011261
nasopharynx0.011261
age0.011261
tanzania0.011261
chronic periodontitis0.011261
central african republic0.011261
bangui0.011261
madagascar0.011261
antananarivo0.011261
ulcerative colitis0.011261
late adult stage0.011261
colombia0.011261
city of dresden0.011261
small village0.011261
stunted growth0.011261
canada0.011261
pregnancy0.011261
age 7 years0.011261
fasting0.009009
trachea0.009009
respiratory failure0.009009
acute respiratory failure0.009009
age 6 months0.009009
acute pericementitis0.009009
bronchus0.009009
esophagus0.009009
Exp. ID User ID Description Date Region Flag Sequences
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens mouth mucosa oral cavity mouth china 2017-10-01v4No1 / 6
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 7
663amnondominant lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 7
679amnondominant saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 7
806amnon high in oral wash oral cavity compared to saliva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 7
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 8
391amnoncommon feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 9
630amnon high in high physical activity compared to sedentary low physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 9
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 10
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
391amnondominant feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
669amnoncommon age 2 months, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 12
777amnondominant age 3 months, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 12
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
48amnondominant homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 13
731amnondominant buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 13
806amnondominant oral cavity, mouth, oral wash, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 13
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 14
576amnondominant homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 14
725amnondominant chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
684amnoncommon middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 14
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
335amnondominant homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant squamous esophagus, esophagus, esophageal disease, hospital, new york city, united states of america, homo sapiens)2028-03-11v4No1 / 15
802amnondominant cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 15
797amnoncommon breast fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
797amnoncommon formula fed, age 1 month, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
805amnondominant sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 15
806amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
806amnondominant dorsum of tongue, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 16
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnondominant homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
663amnondominant pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 16
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
598amnondominant child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 16
652amnondominant sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 16
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
81amnondominant anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
278amnondominant homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 17
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 17
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 17
777amnondominant age 3 years, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
797amnoncommon formula fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 17
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
284amnondominant homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v4No1 / 18
663amnondominant mouth, oral wash, poland, adult, homo sapiens2020-09-22v4No1 / 18
715amnondominant oesophageal brush, esophagus, australia, adult, homo sapiens2028-05-22v4No1 / 18
519amnondominant homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
716amnondominant chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 18
777amnoncommon age 3 months, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant child, age 18 months, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant age 5 years, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
806amnondominant homo sapiens, adult, pair of nares, external naris, state of new york, united states of america2021-06-19v3No1 / 18
806amnondominant mouth mucosa, buccal mucosa, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 18
806amnondominant hard palate, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 18
532amnondominant homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 18
54amnondominant homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
679amnondominant south korea, age 5-10 years, child, fasting, palatine tonsil, tonsil, homo sapiens2028-03-02v3No1 / 19
704amnondominant istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 19
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 19
797amnondominant formula fed, age 1 month, infant, germany, homo sapiens, feces2021-06-13v3No1 / 19
806amnondominant palatine tonsil, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 19
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 20
677amnondominant palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 20
703amnondominant saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 20
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 20
797amnoncommon breast fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant formula fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
576amnondominant homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 21
596amnoncommon homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 21
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 21
716amnondominant control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 21
726amnondominant tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 21
806amnondominant saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 21
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, state of michigan, adult, oropharynx)2021-01-09v4No1 / 22
806amnoncommon gingiva, keratinized gingiva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
284amnondominant homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 23
704amnondominant age 10-15 years, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 23
712amnondominant kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 23
797amnoncommon formula fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
532amnoncommon homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 24
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
663amnoncommon pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 25
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 26
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
685amnoncommon oral cavity, mouth mucosa, australia, adult, homo sapiens2028-03-08v3No1 / 27
711amnoncommon adult, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 29
797amnon high in age 3 months compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 29
806amnoncommon dorsum of tongue, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
796amnon high in graves' disease compared to control in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 31
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No1 / 31
806amnoncommon hard palate, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v4No1 / 32
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 33
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 33
669amnon high in age 2 weeks compared to age 1 year in sweden infant feces homo sapiens 2020-09-26v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
509amnon high in urinary schistosomiasis schistosomiasis compared to control in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 34
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
596amnoncommon homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
596amnoncommon homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 37
711amnoncommon age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 37
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
679amnoncommon saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 38
806amnoncommon homo sapiens, adult, pair of nares, external naris, state of new york, united states of america2021-06-19v3No1 / 38
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
677amnoncommon palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
806amnoncommon mouth mucosa, buccal mucosa, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
806amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 42
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 44
797amnon high in age 7 months compared to age 1 year in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 44
773amnoncommon recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 47
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
806amnoncommon palatine tonsil, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
736amnoncommon age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
576amnon high in tongue compared to mouth mucosa in homo sapiens czech republic adult 2020-01-09v3No1 / 50
797amnoncommon breast fed, age 2 years, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
725amnoncommon control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 51
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong 2nd generation hmong in homo sapiens feces )2018-11-18v4No1 / 52
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 52
773amnoncommon iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 54
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
596amnoncommon homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 57
806amnon high in oral wash oral cavity compared to supragingival plaque supragingival dental plaque dentition in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 58
596amnoncommon homo sapiens, sweden, saliva, child, age 7 years2020-03-17v3No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 60
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
679amnoncommon south korea, age 5-10 years, child, fasting, palatine tonsil, tonsil, homo sapiens2028-03-02v3No1 / 64
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
576amnoncommon homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
576amnoncommon homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 67
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common squamous esophagus, esophagus, esophageal disease, hospital, new york city, united states of america, homo sapiens)2028-03-11v4No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
797amnon high in formula fed compared to breast fed in germany age 1 month infant feces homo sapiens 2021-06-13v3No1 / 69
803amnoncommon type 2 diabetes mellitus, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 70
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
576amnoncommon homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 71
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
716amnoncommon control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 74
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 74
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
797amnon high in formula fed compared to breast fed in age 3 months germany infant feces homo sapiens 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common oropharynx, adult, state of michigan, united states of america, homo sapiens)2021-01-09v4No1 / 77
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 77
596amnon high in age <1 year compared to age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
777amnoncommon age 18 months, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 79
777amnon high in age 3 months infant compared to age 18 months child in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 79
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
658amnoncommon european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 82
716amnoncommon chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 82
777amnoncommon age 5 years, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 83
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 84
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
731amnoncommon buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 85
802amnoncommon cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 85
806amnoncommon oral cavity, mouth, oral wash, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
805amnoncommon sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 88
803amnoncommon control, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 89
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
715amnoncommon oesophageal brush, esophagus, australia, adult, homo sapiens2028-05-22v4No1 / 92
725amnoncommon chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 92
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 92
777amnoncommon age 3 years, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 92
658amnoncommon hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 93
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in child age 2-4 years compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
658amnoncommon african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 98
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
704amnoncommon age 10-15 years, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 105
663amnoncommon mouth, oral wash, poland, adult, homo sapiens2020-09-22v4No1 / 106
712amnoncommon kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 106
806amnoncommon saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
704amnoncommon istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 107
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
703amnoncommon saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
777amnon high in age 5 years compared to age 3 years in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
598amnoncommon child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
725amnoncommon periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
605amnon high in recurrent otitis media compared to control in australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 149
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 152
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
658amnoncommon asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 157
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
777amnon high in age 3 years compared to age 18 months in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 184
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
777amnon high in age 3 months compared to age 2 days in infant homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 197
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
806amnon high in oral wash oral cavity compared to keratinized gingiva gingiva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 288
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 291
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 301
723amnon high in age 2-4 years compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 306
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in adult age 25-45 years female china scalp skin homo sapiens 2021-07-12v1No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
808amnon high in ileal mucosa mucosa compared to digesta in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 1360
819amnon high in skin of cheek compared to scalp in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 1684

Problems / suggestions? Please email info AT dbbact DOT org