Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGCCATTGGAAACTGGAAGGCTTGAGTACAGAAGAGAAGAGTGGAATTCCACG
common ontology terms
term enrichment score
TermScore
skin0.341615
fresh water0.248447
pond0.238806
river0.192771
koshi river0.190476
nepal0.173913
depth 10 cm0.160000
intestine0.153355
brazil0.151899
water0.140351
filtered 2.7um0.140351
tributary0.135593
frog0.123077
fish0.119760
leaf0.118577
canada0.108108
arm0.108108
pond water0.102564
filtered 0.2um0.100000
tadpole0.100000
particle bound0.100000
soybean0.100000
glycine max0.095238
free floating0.090909
pair of nares0.088889
depth 0-20cm0.083333
united states of america0.076496
amphibian larval stage0.074074
venezuela0.074074
amerindian0.074074
scinax fuscovarius0.072727
astyanax paranae0.072727
astyanax0.072727
poecilia reticulata0.072727
guppy0.072727
swan goose0.072727
southern united states0.072727
aquatic snake0.072727
hunter gatherer0.072727
maryland county0.072727
populus0.072727
spring water0.072727
chuquisaca department0.072727
forearm0.072727
mississippi river0.072727
LOWER IN free floating0.072727
anser cygnoides0.070175
snake0.070175
age 5-13 years0.070175
LOWER IN mouth0.068966
inguinal region0.067797
bolivia0.067797
state of tennessee0.065574
tree0.065574
farm0.064516
japan0.064516
horse0.063492
LOWER IN soil0.063492
larval stage0.062500
equus caballus0.061538
bird0.059701
cultivated environment0.059701
nasal cavity0.057971
rural community0.057971
digestive system0.054795
winter0.049383
state of florida0.049383
canis lupus familiaris0.048193
china0.045627
homo sapiens0.044743
child0.041237
rhizosphere0.040000
lesser foam frog0.037736
scinax perereca0.037736
andrias japonicus0.037736
japanese giant salamander0.037736
fire salamander0.037736
pteropus giganteus0.037736
indian flying fox0.037736
african lion safari0.037736
nerodia sipedon0.037736
northern water snake0.037736
turtle farm0.037736
LOWER IN mongolia0.037736
anterior naris0.037736
coarse-loamy soil0.037736
stover ammendment soil0.037736
day 120.037736
LOWER IN day 10.037736
lithobates catesbeianus0.037736
LOWER IN barn0.037736
LOWER IN hay0.037736
pseudacris crucifer0.037736
peeper0.037736
populus deltoides0.037736
LOWER IN populus trichocarpa x deltoides0.037736
location 20.037736
guanajuato0.037736
agave0.037736
location 40.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
filtered 2.7um0.666667
amphibian larval stage0.666667
canada0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
koshi river0.500000
tributary0.500000
pond0.500000
scinax fuscovarius0.500000
astyanax paranae0.500000
astyanax0.500000
poecilia reticulata0.500000
guppy0.500000
lesser foam frog0.500000
scinax perereca0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
fire salamander0.500000
swan goose0.500000
pteropus giganteus0.500000
indian flying fox0.500000
african lion safari0.500000
southern united states0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
turtle farm0.500000
LOWER IN mongolia0.500000
anterior naris0.500000
hunter gatherer0.500000
coarse-loamy soil0.500000
stover ammendment soil0.500000
day 120.500000
LOWER IN day 10.500000
lithobates catesbeianus0.500000
maryland county0.500000
LOWER IN barn0.500000
LOWER IN hay0.500000
pseudacris crucifer0.500000
peeper0.500000
populus0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
spring water0.500000
location 20.500000
guanajuato0.500000
agave0.500000
location 40.500000
LOWER IN oral cavity0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN solanum lycopersicum0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
LOWER IN terrestrial snake0.500000
depth 1m0.500000
mississippi river0.500000
LOWER IN free floating0.500000
LOWER IN filtered 0.2um0.500000
aquatic biome0.500000
particles0.500000
LOWER IN root structure0.500000
skin0.407407
pond water0.400000
nepal0.333333
filtered 0.2um0.333333
tadpole0.333333
particle bound0.333333
age 21 days0.333333
salamandra salamandra0.333333
stream0.333333
anser cygnoides0.333333
snake0.333333
hainan autonomous prefecture0.333333
LOWER IN nasopharynx0.333333
new york0.333333
rana catesbeiana0.333333
bullfrog0.333333
pasture0.333333
brassica oleracea0.333333
seed0.333333
LOWER IN seedling0.333333
soybean0.333333
foot0.333333
diabetes mellitus0.333333
age 5-13 years0.333333
LOWER IN stem0.333333
LOWER IN mouth mucosa0.333333
LOWER IN human contact0.333333
particle0.333333
frog0.285714
LOWER IN mouth0.285714
fresh water0.263158
river0.250000
Fraction of annotations for the query sequences containing the term
TermScore
skin0.294118
united states of america0.254902
water0.235294
fresh water0.235294
brazil0.176471
river0.156863
pond0.156863
intestine0.156863
depth 10 cm0.117647
koshi river0.117647
nepal0.117647
digestive system0.117647
china0.117647
homo sapiens0.117647
fish0.098039
leaf0.098039
tributary0.078431
frog0.078431
filtered 2.7um0.078431
free floating0.058824
filtered 0.2um0.058824
tadpole0.058824
pond water0.058824
particle bound0.058824
research facility0.058824
adult0.058824
canada0.058824
farm0.058824
pair of nares0.058824
arm0.058824
depth 0-20cm0.058824
rhizosphere0.058824
glycine max0.058824
soybean0.058824
scinax fuscovarius0.039216
astyanax paranae0.039216
astyanax0.039216
poecilia reticulata0.039216
guppy0.039216
canis lupus familiaris0.039216
inguinal region0.039216
amphibian larval stage0.039216
larval stage0.039216
japan0.039216
anser cygnoides0.039216
swan goose0.039216
bird0.039216
feces0.039216
winter0.039216
snake0.039216
southern united states0.039216
aquatic snake0.039216
venezuela0.039216
amerindian0.039216
hunter gatherer0.039216
soil0.039216
maryland county0.039216
equus caballus0.039216
horse0.039216
nasal cavity0.039216
state of tennessee0.039216
populus0.039216
tree0.039216
cultivated environment0.039216
state of florida0.039216
spring water0.039216
LOWER IN soil0.039216
LOWER IN mouth0.039216
control0.039216
child0.039216
age 5-13 years0.039216
bolivia0.039216
rural community0.039216
chuquisaca department0.039216
forearm0.039216
mississippi river0.039216
LOWER IN free floating0.039216
lesser foam frog0.019608
scinax perereca0.019608
zebra fish0.019608
danio rerio0.019608
juvenile organism0.019608
age 21 days0.019608
state of oregon0.019608
andrias japonicus0.019608
japanese giant salamander0.019608
LOWER IN adult0.019608
salamandra salamandra0.019608
fire salamander0.019608
germany0.019608
stream0.019608
pteropus giganteus0.019608
indian flying fox0.019608
zoological garden0.019608
captive0.019608
african lion safari0.019608
nerodia sipedon0.019608
northern water snake0.019608
turtle farm0.019608
hainan autonomous prefecture0.019608
Exp. ID User ID Description Date Region Flag Sequences
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
499amnondominant brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 14
499amnondominant brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
499amnondominant brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 17
61amnondominant canis lupus familiaris, united states of america, skin, inguinal region, research facility2017-02-05v4No1 / 23
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 30
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
338amnon high in amphibian larval stage larval stage tadpole compared to adult in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 59
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org