Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGCCATTGGAAACTGGAAGGCTTGAGTACAGAAGAGAAGAGTGGAATTCCACG
common ontology terms
term enrichment score
TermScore
skin0.369955
pond0.253968
fresh water0.217391
koshi river0.203390
river0.202532
nepal0.184615
intestine0.173285
depth 10 cm0.169014
brazil0.163636
filtered 2.7um0.150943
tributary0.145455
fish0.134228
frog0.131148
leaf0.127119
canada0.120000
arm0.116505
filtered 0.2um0.107143
tadpole0.107143
particle bound0.107143
soybean0.107143
glycine max0.101695
free floating0.096774
pair of nares0.096774
depth 0-20cm0.096774
water0.095745
amphibian larval stage0.080000
venezuela0.080000
amerindian0.080000
scinax fuscovarius0.078431
astyanax paranae0.078431
astyanax0.078431
poecilia reticulata0.078431
guppy0.078431
swan goose0.078431
southern united states0.078431
aquatic snake0.078431
hunter gatherer0.078431
maryland county0.078431
populus0.078431
chuquisaca department0.078431
forearm0.078431
mississippi river0.078431
LOWER IN free floating0.078431
anser cygnoides0.075472
snake0.075472
age 5-13 years0.075472
LOWER IN mouth0.074074
pond water0.072727
inguinal region0.072727
horse0.072727
bolivia0.072727
equus caballus0.070175
state of tennessee0.070175
tree0.070175
japan0.068966
LOWER IN soil0.068966
larval stage0.066667
bird0.065574
rural community0.065574
united states of america0.063665
cultivated environment0.063492
nasal cavity0.061538
digestive system0.057416
winter0.051948
canis lupus familiaris0.050633
homo sapiens0.048504
rhizosphere0.046875
child0.045977
farm0.043011
lesser foam frog0.040816
scinax perereca0.040816
andrias japonicus0.040816
japanese giant salamander0.040816
fire salamander0.040816
african lion safari0.040816
indian flying fox0.040816
pteropus giganteus0.040816
nerodia sipedon0.040816
northern water snake0.040816
LOWER IN mongolia0.040816
anterior naris0.040816
lithobates catesbeianus0.040816
LOWER IN barn0.040816
LOWER IN hay0.040816
pseudacris crucifer0.040816
peeper0.040816
populus deltoides0.040816
LOWER IN populus trichocarpa x deltoides0.040816
guanajuato0.040816
agave0.040816
LOWER IN oral cavity0.040816
LOWER IN wound0.040816
LOWER IN ulcer0.040816
LOWER IN stem0.040816
LOWER IN solanum lycopersicum0.040816
bank vole0.040816
myodes glareolus0.040816
ukraine0.040816
no human contact0.040816
chernobyl exclusion zone0.040816
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
filtered 2.7um0.666667
amphibian larval stage0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
koshi river0.500000
tributary0.500000
pond0.500000
scinax fuscovarius0.500000
astyanax paranae0.500000
astyanax0.500000
poecilia reticulata0.500000
guppy0.500000
lesser foam frog0.500000
scinax perereca0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
fire salamander0.500000
swan goose0.500000
african lion safari0.500000
indian flying fox0.500000
pteropus giganteus0.500000
southern united states0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
LOWER IN mongolia0.500000
anterior naris0.500000
hunter gatherer0.500000
lithobates catesbeianus0.500000
maryland county0.500000
LOWER IN barn0.500000
LOWER IN hay0.500000
pseudacris crucifer0.500000
peeper0.500000
populus0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
guanajuato0.500000
agave0.500000
LOWER IN oral cavity0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN stem0.500000
LOWER IN solanum lycopersicum0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
LOWER IN terrestrial snake0.500000
depth 1m0.500000
mississippi river0.500000
LOWER IN free floating0.500000
LOWER IN filtered 0.2um0.500000
aquatic biome0.500000
particles0.500000
LOWER IN root structure0.500000
skin0.440000
nepal0.333333
filtered 0.2um0.333333
tadpole0.333333
particle bound0.333333
age 21 days0.333333
salamandra salamandra0.333333
stream0.333333
anser cygnoides0.333333
snake0.333333
LOWER IN nasopharynx0.333333
rana catesbeiana0.333333
bullfrog0.333333
pasture0.333333
brassica oleracea0.333333
seed0.333333
LOWER IN seedling0.333333
leaf surface0.333333
soybean0.333333
foot0.333333
diabetes mellitus0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
LOWER IN human contact0.333333
particle0.333333
frog0.285714
LOWER IN mouth0.285714
river0.250000
depth 10 cm0.250000
pond water0.250000
inguinal region0.250000
juvenile organism0.250000
horse0.250000
glycine max0.250000
bolivia0.250000
fresh water0.222222
free floating0.200000
zebra fish0.200000
state of oregon0.200000
Fraction of annotations for the query sequences containing the term
TermScore
skin0.319149
fresh water0.212766
united states of america0.212766
water0.191489
brazil0.191489
river0.170213
pond0.170213
intestine0.170213
depth 10 cm0.127660
koshi river0.127660
nepal0.127660
digestive system0.127660
homo sapiens0.127660
fish0.106383
china0.106383
leaf0.106383
tributary0.085106
frog0.085106
filtered 2.7um0.085106
free floating0.063830
filtered 0.2um0.063830
tadpole0.063830
particle bound0.063830
research facility0.063830
adult0.063830
canada0.063830
pair of nares0.063830
arm0.063830
depth 0-20cm0.063830
rhizosphere0.063830
glycine max0.063830
soybean0.063830
scinax fuscovarius0.042553
astyanax paranae0.042553
astyanax0.042553
pond water0.042553
poecilia reticulata0.042553
guppy0.042553
canis lupus familiaris0.042553
inguinal region0.042553
amphibian larval stage0.042553
larval stage0.042553
japan0.042553
anser cygnoides0.042553
swan goose0.042553
bird0.042553
feces0.042553
winter0.042553
snake0.042553
southern united states0.042553
aquatic snake0.042553
venezuela0.042553
amerindian0.042553
hunter gatherer0.042553
maryland county0.042553
equus caballus0.042553
horse0.042553
farm0.042553
nasal cavity0.042553
state of tennessee0.042553
populus0.042553
tree0.042553
cultivated environment0.042553
LOWER IN soil0.042553
LOWER IN mouth0.042553
control0.042553
child0.042553
age 5-13 years0.042553
bolivia0.042553
rural community0.042553
chuquisaca department0.042553
forearm0.042553
mississippi river0.042553
LOWER IN free floating0.042553
lesser foam frog0.021277
scinax perereca0.021277
zebra fish0.021277
danio rerio0.021277
juvenile organism0.021277
age 21 days0.021277
state of oregon0.021277
andrias japonicus0.021277
japanese giant salamander0.021277
LOWER IN adult0.021277
salamandra salamandra0.021277
fire salamander0.021277
germany0.021277
stream0.021277
african lion safari0.021277
captive0.021277
zoological garden0.021277
indian flying fox0.021277
pteropus giganteus0.021277
nerodia sipedon0.021277
northern water snake0.021277
LOWER IN mongolia0.021277
LOWER IN summer0.021277
LOWER IN nasopharynx0.021277
anterior naris0.021277
belgium0.021277
Exp. ID User ID Description Date Region Flag Sequences
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
499amnonhighfreq brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
499amnonhighfreq brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 14
499amnonhighfreq brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
499amnonhighfreq brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 17
61amnonhighfreq canis lupus familiaris, united states of america, skin, inguinal region, research facility2017-02-05v4No1 / 23
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 30
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
338amnon high in amphibian larval stage larval stage tadpole compared to adult in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 59
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
384amnon high in pasture compared to barn hay in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 304
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 315
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org