Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCTTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAGGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
china0.949153
homo sapiens0.209014
adult0.201923
feces0.177754
13-year-old human stage0.126984
taiwan0.126984
young adult stage0.123077
fifth decade human stage0.098361
india0.091603
fourth decade human stage0.091603
israel0.089888
obsolete_juvenile stage0.085714
female0.084720
control0.069869
coronary heart disease0.067797
third trimester0.067797
taipei city0.067797
nanning city prefecture0.067797
sixth decade human stage0.067797
age 13-140.067797
LOWER IN age >940.067797
LOWER IN tenth decade human stage0.067797
pregnancy0.065934
toronto0.065574
athlete0.065574
republic of china0.065574
14-year-old human stage0.065574
LOWER IN ninth decade human stage0.065574
effluent0.063492
high physical activity0.061538
guangzhou city prefecture0.061538
wastewater treatment plant0.061538
juvenile organism0.059701
crohn's disease0.059701
autumn0.049383
united states of america0.046358
bile0.035714
mexico0.035714
LOWER IN cuba0.035714
LOWER IN acute pancreatitis0.035714
LOWER IN pancreatitis0.035714
spring0.035714
azerbaijan0.035088
autoimmune hepatitis0.035088
zhengzhou city prefecture0.035088
LOWER IN diarrhea0.035088
LOWER IN nephrolithiasis0.035088
denver0.035088
cholelithiasis0.035088
gallbladder0.035088
age 8-120.035088
LOWER IN age 3-60.035088
low anterior resection0.035088
soldiers0.035088
cron diet0.035088
hefei city prefecture0.035088
baijiu0.035088
days 0-900.035088
shanghai district0.034483
first trimester0.034483
65-79 year-old human stage0.034483
LOWER IN 65-79 year-old human stage0.034483
nanchang city prefecture0.034483
asian0.034483
metabolic syndrome0.034483
LOWER IN american diet0.034483
mud0.034483
fermentation pit mud0.034483
type 2 diabetes mellitus0.033898
LOWER IN gay0.033898
hispanic or latin american0.033898
small village0.033898
LOWER IN fifth decade human stage0.033898
LOWER IN caucasian0.033898
LOWER IN european0.033898
heterosexual0.033333
msw0.033333
6-12 year-old child stage0.033333
caloric restriction diet0.033333
LOWER IN homosexual0.032787
LOWER IN msm0.032787
obesity0.032258
LOWER IN finland0.032258
LOWER IN fourth decade human stage0.032258
ulcerative colitis0.031746
belgium0.031746
kingdom of denmark0.031746
kingdom of norway0.031746
state of colorado0.031250
LOWER IN low bmi0.031250
zhejiang province0.030769
LOWER IN hiv infection0.030769
sheep0.030769
jiangsu province0.030303
body mass index0.030303
LOWER IN 2-5 year-old child stage0.030303
rural community0.030303
south korea0.029851
state of new york0.029851
river0.029851
Fraction of dbbact annotations with this term covered by the query
TermScore
china7.000000
bile1.000000
mexico1.000000
LOWER IN cuba1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
spring1.000000
azerbaijan0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
13-year-old human stage0.500000
taiwan0.500000
coronary heart disease0.500000
third trimester0.500000
fifth decade human stage0.500000
LOWER IN diarrhea0.500000
taipei city0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
denver0.500000
cholelithiasis0.500000
gallbladder0.500000
age 13-140.500000
age 8-120.500000
LOWER IN age 3-60.500000
low anterior resection0.500000
LOWER IN age >940.500000
LOWER IN tenth decade human stage0.500000
soldiers0.500000
cron diet0.500000
hefei city prefecture0.500000
baijiu0.500000
days 0-900.500000
young adult stage0.400000
toronto0.333333
athlete0.333333
shanghai district0.333333
republic of china0.333333
first trimester0.333333
14-year-old human stage0.333333
65-79 year-old human stage0.333333
LOWER IN ninth decade human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
nanchang city prefecture0.333333
asian0.333333
metabolic syndrome0.333333
LOWER IN american diet0.333333
mud0.333333
fermentation pit mud0.333333
india0.285714
fourth decade human stage0.285714
type 2 diabetes mellitus0.250000
LOWER IN gay0.250000
hispanic or latin american0.250000
small village0.250000
LOWER IN fifth decade human stage0.250000
LOWER IN caucasian0.250000
LOWER IN european0.250000
effluent0.250000
obsolete_juvenile stage0.200000
high physical activity0.200000
guangzhou city prefecture0.200000
heterosexual0.200000
msw0.200000
6-12 year-old child stage0.200000
caloric restriction diet0.200000
wastewater treatment plant0.200000
juvenile organism0.166667
crohn's disease0.166667
LOWER IN homosexual0.166667
LOWER IN msm0.166667
obesity0.142857
LOWER IN finland0.142857
LOWER IN fourth decade human stage0.142857
ulcerative colitis0.125000
belgium0.125000
kingdom of denmark0.125000
kingdom of norway0.125000
adult0.121387
homo sapiens0.118081
israel0.117647
state of colorado0.111111
LOWER IN low bmi0.111111
zhejiang province0.100000
LOWER IN hiv infection0.100000
sheep0.100000
feces0.098726
jiangsu province0.090909
body mass index0.090909
LOWER IN 2-5 year-old child stage0.090909
rural community0.090909
pregnancy0.083333
south korea0.083333
state of new york0.083333
river0.083333
ovis aries0.083333
high bmi0.076923
autumn0.076923
female0.063492
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.909091
feces0.890909
adult0.600000
china0.509091
control0.181818
female0.127273
united states of america0.127273
young adult stage0.072727
13-year-old human stage0.072727
taiwan0.072727
israel0.072727
obsolete_juvenile stage0.054545
india0.054545
pregnancy0.054545
fourth decade human stage0.054545
fifth decade human stage0.054545
toronto0.036364
high physical activity0.036364
athlete0.036364
juvenile organism0.036364
coronary heart disease0.036364
republic of china0.036364
third trimester0.036364
guangzhou city prefecture0.036364
crohn's disease0.036364
LOWER IN control0.036364
taipei city0.036364
nanning city prefecture0.036364
sixth decade human stage0.036364
age 13-140.036364
14-year-old human stage0.036364
LOWER IN age >940.036364
LOWER IN ninth decade human stage0.036364
LOWER IN tenth decade human stage0.036364
autumn0.036364
wastewater treatment plant0.036364
effluent0.036364
LOWER IN male0.018182
child0.018182
azerbaijan0.018182
autoimmune hepatitis0.018182
zhengzhou city prefecture0.018182
zhejiang province0.018182
type 2 diabetes mellitus0.018182
obesity0.018182
shanghai district0.018182
south korea0.018182
LOWER IN diarrhea0.018182
ulcerative colitis0.018182
LOWER IN hiv infection0.018182
belgium0.018182
LOWER IN nephrolithiasis0.018182
heterosexual0.018182
msw0.018182
LOWER IN gay0.018182
LOWER IN homosexual0.018182
LOWER IN msm0.018182
state of colorado0.018182
denver0.018182
first trimester0.018182
cholelithiasis0.018182
bile0.018182
gallbladder0.018182
kingdom of spain0.018182
jiangsu province0.018182
mexico0.018182
LOWER IN cuba0.018182
hispanic or latin american0.018182
body mass index0.018182
high bmi0.018182
LOWER IN low bmi0.018182
age 8-120.018182
6-12 year-old child stage0.018182
LOWER IN age 3-60.018182
LOWER IN 2-5 year-old child stage0.018182
low anterior resection0.018182
LOWER IN finland0.018182
65-79 year-old human stage0.018182
brazil0.018182
small village0.018182
rural community0.018182
LOWER IN child0.018182
soldiers0.018182
LOWER IN adult0.018182
LOWER IN 65-79 year-old human stage0.018182
LOWER IN fourth decade human stage0.018182
LOWER IN fifth decade human stage0.018182
LOWER IN acute pancreatitis0.018182
LOWER IN pancreatitis0.018182
nanchang city prefecture0.018182
asian0.018182
LOWER IN caucasian0.018182
LOWER IN european0.018182
state of new york0.018182
metabolic syndrome0.018182
kingdom of denmark0.018182
river0.018182
water0.018182
diet0.018182
cron diet0.018182
Exp. ID User ID Description Date Region Flag Sequences
10amnon high in female compared to male in feces homo sapiens toronto 2016-10-27v4No1 / 10
365amnondominant feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 16
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
329amnoncommon rumen, ovis aries, kingdom of norway, sheep2018-05-13v4No1 / 506
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573

Problems / suggestions? Please email info AT dbbact DOT org