Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.620007
saliva0.316810
adult0.307092
united states of america0.230104
child0.224195
mouth0.208403
feces0.185682
dentition0.162910
infant0.143345
subgingival plaque0.139649
china0.122727
mouth mucosa0.089888
canada0.085161
LOWER IN control0.084433
control0.083406
oral cavity0.082243
nasopharynx0.080586
bolivia0.080586
czech republic0.075993
farm0.074144
obsolete_juvenile stage0.073801
duodenum0.073126
skin0.069756
pair of nares0.065814
nasal cavity0.064748
research facility0.063628
amerindian0.060837
venezuela0.060837
india0.060377
hunter gatherer0.059925
africa0.059925
age0.058442
crohn's disease0.053846
tongue0.053299
belgium0.053181
state of michigan0.052369
pig0.051471
sus scrofa0.051471
rural community0.050817
horse0.050179
city0.049866
state of california0.049252
equus caballus0.048951
tonsil0.046154
bronchial epithelium0.045977
chuquisaca department0.045627
kingdom of the netherlands0.044610
age 5-13 years0.044610
italy0.044280
monkey0.043636
australia0.040541
finland0.038499
united kingdom0.038462
stunted growth0.038314
macaca mulatta0.037594
puerto rico0.037594
LOWER IN adult0.037313
LOWER IN feces0.037071
brazil0.034965
state of new york0.031128
bronchus0.031128
ulcerative colitis0.031008
lung0.030888
age 1-7 years0.030888
centrocercus urophasianus0.030888
greater sage-grouse0.030888
state of wyoming0.030888
kingdom of denmark0.030418
sichuan province0.030418
LOWER IN caecum0.030265
mucus0.029091
state of florida0.028881
bird0.028674
female0.026997
trachea0.023483
atlanta0.023483
arm0.023483
LOWER IN dentition0.023438
lower labial mucosa0.023346
lip0.023346
bronchial brush0.023346
barn0.023346
hay0.023346
antananarivo0.023346
madagascar0.023346
atherosclerosis0.023346
central african republic0.023346
bangui0.023346
urban biome0.023346
age 7-14 years0.023346
south florida0.023346
shark0.023346
age 130.023346
french republic0.023256
breast milk0.023211
colombia0.023211
vagina0.023077
hospital0.023077
LOWER IN periodontitis0.023077
pasture0.023077
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
LOWER IN sinusitis1.000000
subgingival plaque0.900000
saliva0.840000
crohn's disease0.777778
mouth mucosa0.750000
dentition0.733333
mouth0.666667
amerindian0.666667
venezuela0.666667
state of new york0.666667
bronchus0.666667
oral cavity0.666667
trachea0.666667
atlanta0.666667
age < 3 years0.666667
sputum0.666667
tonsil0.666667
oral wash0.666667
arm0.666667
male0.666667
LOWER IN supragingival plaque0.666667
child0.650000
tongue0.600000
bronchial epithelium0.600000
LOWER IN dentition0.600000
belgium0.571429
ulcerative colitis0.571429
finland0.571429
india0.571429
united kingdom0.555556
homo sapiens0.526946
LOWER IN last trimester0.500000
nasopharynx0.500000
infant0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age >=7 days0.500000
bolivia0.500000
chuquisaca department0.500000
common variable immunodeficiency0.500000
LOWER IN chronic gastritis0.500000
hypopharynx0.500000
hunter gatherer0.500000
lung0.500000
idiopathic pulmonary fibrosis0.500000
age 2-4 years0.500000
LOWER IN aphthous stomatitis0.500000
lower labial mucosa0.500000
lip0.500000
buccal mucosa0.500000
bronchial brush0.500000
barn0.500000
hay0.500000
inflammatory bowel disease0.500000
phoenix0.500000
LOWER IN dysplasia of cervix0.500000
gastric bypass0.500000
age <= 24 hours0.500000
age 1-7 years0.500000
LOWER IN induced periodontitis0.500000
tracheal aspirate0.500000
respiratory technology dependent0.500000
invasive carcinoma0.500000
invasive cervical carcinoma0.500000
cervical carcinoma0.500000
obsolete_juvenile stage0.500000
outdoor0.500000
lapland0.500000
LOWER IN state of colorado0.500000
anterior naris0.500000
age<17 years0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
stunted growth0.500000
atherosclerosis0.500000
central african republic0.500000
bangui0.500000
LOWER IN age 12-23 years0.500000
sigmoid colon0.500000
children0.500000
cheek0.500000
drosophila melanogaster0.500000
fruit fly0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
morning0.500000
slovak republic0.500000
age 21-28 years0.500000
age 0-10.500000
LOWER IN age 1-20.500000
nicotiana galuca0.500000
liver carcinoma0.500000
dermal layer of tongue0.500000
induced sputum0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.752988
united states of america0.274900
adult0.262948
feces0.195219
saliva0.195219
child0.135458
mouth0.123506
china0.107570
dentition0.091633
infant0.083665
subgingival plaque0.075697
control0.067729
LOWER IN control0.063745
farm0.051793
research facility0.051793
mouth mucosa0.047809
nasopharynx0.043825
bolivia0.043825
czech republic0.043825
canada0.043825
oral cavity0.043825
skin0.039841
obsolete_juvenile stage0.039841
duodenum0.039841
nasal cavity0.035857
age0.035857
pair of nares0.035857
amerindian0.031873
hunter gatherer0.031873
venezuela0.031873
india0.031873
africa0.031873
rural community0.027888
tongue0.027888
belgium0.027888
equus caballus0.027888
horse0.027888
crohn's disease0.027888
state of california0.027888
state of michigan0.027888
pig0.027888
sus scrofa0.027888
city0.027888
kingdom of the netherlands0.023904
age 5-13 years0.023904
chuquisaca department0.023904
australia0.023904
italy0.023904
bronchial epithelium0.023904
monkey0.023904
tonsil0.023904
macaca mulatta0.019920
puerto rico0.019920
finland0.019920
stunted growth0.019920
LOWER IN adult0.019920
brazil0.019920
united kingdom0.019920
LOWER IN feces0.019920
female0.015936
kingdom of denmark0.015936
state of new york0.015936
lung0.015936
sichuan province0.015936
bronchus0.015936
ulcerative colitis0.015936
age 1-7 years0.015936
mucus0.015936
bird0.015936
centrocercus urophasianus0.015936
greater sage-grouse0.015936
state of wyoming0.015936
LOWER IN caecum0.015936
state of florida0.015936
vagina0.011952
hospital0.011952
breast milk0.011952
LOWER IN periodontitis0.011952
lower labial mucosa0.011952
lip0.011952
bronchial brush0.011952
barn0.011952
hay0.011952
pasture0.011952
mouth neoplasm0.011952
cancer0.011952
trachea0.011952
atlanta0.011952
antananarivo0.011952
madagascar0.011952
atherosclerosis0.011952
stomach0.011952
central african republic0.011952
bangui0.011952
colon0.011952
LOWER IN saliva0.011952
LOWER IN dentition0.011952
colombia0.011952
urban biome0.011952
shanghai proper0.011952
Exp. ID User ID Description Date Region Flag Sequences
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 3
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 6
517amnonhighfreq homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
133amnonhigh freq. in infants 0-1 years (highfreq homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 11
567amnoncommon nasopharynx, homo sapiens, adult, belgium2019-12-05v4No1 / 11
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (highfreq homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age, age 3 months)2017-10-30v4No1 / 12
35amnonhighfreq tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
48amnonhighfreq homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 13
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
469amnonhighfreq homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
564amnon high in control compared to autistic disorder in feces italy age 2-4 years child homo sapiens 2019-11-18v3No1 / 14
576amnon high in control compared to aphthous stomatitis in lower labial mucosa mouth mucosa lip adult czech republic homo sapiens 2020-01-09v3No1 / 14
576amnonhighfreq lower labial mucosa, mouth mucosa, lip, adult, czech republic, homo sapiens2020-01-09v3No1 / 14
576amnonhighfreq buccal mucosa, mouth mucosa, adult, czech republic, homo sapiens2020-01-09v3No1 / 14
48amnoncommon homo sapiens, kingdom of denmark, infant, hypopharynx2017-01-19v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (highfreq homo sapiens, saliva)2017-02-15v4No1 / 15
64amnonhighfreq saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
335amnonhighfreq homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
354amnonhighfreq homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
371amnonhighfreq homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
384amnonhighfreq equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 15
524amnonhighfreq homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
319amnonhighfreq homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnonhighfreq homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 16
576amnon high in aphthous stomatitis compared to control in tongue adult czech republic homo sapiens 2020-01-09v3No1 / 16
32amnonhighfreq homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnonhighfreq homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (highfreq homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
278amnonhighfreq homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnonhighfreq homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (highfreq homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
384amnonhighfreq equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 18
299amnonhighfreq saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
542amnonhighfreq subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 19
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (highfreq saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (highfreq homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (highfreq homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
75amnonhighfreq homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
203amnonhighfreq homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 21
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 21
567amnoncommon pair of nares, anterior naris, homo sapiens, adult, belgium2019-12-05v4No1 / 21
576amnon high in control compared to aphthous stomatitis in adult czech republic mouth homo sapiens 2020-01-09v3No1 / 21
576amnonhighfreq tongue, adult, czech republic, homo sapiens2020-01-09v3No1 / 21
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
425amnonhighfreq homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
455amnonhighfreq homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
576amnon high in mouth mucosa compared to tongue in adult czech republic homo sapiens 2020-01-09v3No1 / 22
425amnonhighfreq homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
173amnonhighfreq homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnonhighfreq homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 24
260amnonhighfreq homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
425amnonhighfreq homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces infant india )2016-12-19v4No1 / 56
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
572amnoncommon liver carcinoma, china, dermal layer of tongue, tongue, homo sapiens2019-12-16v3No1 / 60
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
576amnoncommon lower labial mucosa, mouth mucosa, lip, adult, czech republic, homo sapiens2020-01-09v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
576amnoncommon tongue, adult, czech republic, homo sapiens2020-01-09v3No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
572amnoncommon pancreatic cancer, china, dermal layer of tongue, tongue, homo sapiens2019-12-16v3No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
576amnoncommon buccal mucosa, mouth mucosa, adult, czech republic, homo sapiens2020-01-09v3No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 83
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
323amnoncommon freq. in shark teeth (common atlantic ocean, south florida, state of florida, united states of america, shark, dentition)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
578amnon high in kingdom of spain compared to sweden in homosexual gay msm male adult hiv infection feces homo sapiens 2020-01-14v3No1 / 133
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
384amnoncommon equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 274
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 425
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
384amnon high in oral cavity saliva mouth compared to pair of nares nasal cavity in equus caballus horse canada farm 2018-10-22v4No1 / 604
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org