Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGAAAATAAGTCTGTTTTAAAAGTGCGGGGCTCAACCCCGTGATGGAATGGAAACTGTTTTTCTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
usa born0.200000
LOWER IN non usa born0.200000
toronto0.181818
LOWER IN asian0.181818
hispanic or latin american0.166667
LOWER IN vancomycin0.166667
LOWER IN neomycin0.166667
caucasian0.166667
european0.166667
LOWER IN thailand0.142857
LOWER IN 1-month-old human stage0.142857
LOWER IN metronidazole0.133333
belgium0.125000
kingdom of denmark0.125000
LOWER IN rural community0.105263
crohn's disease0.100000
state of new york0.100000
1-year-old human stage0.086957
LOWER IN antibiotic0.083333
age0.068966
state of california0.058824
infant0.058824
homo sapiens0.057348
feces0.049689
LOWER IN male0.048780
LOWER IN child0.045455
adult0.044199
united states of america0.039216
female0.028169
LOWER IN control0.010363
control0.010363
Fraction of dbbact annotations with this term covered by the query
TermScore
usa born0.500000
LOWER IN non usa born0.500000
toronto0.333333
LOWER IN asian0.333333
hispanic or latin american0.250000
LOWER IN vancomycin0.250000
LOWER IN neomycin0.250000
caucasian0.250000
european0.250000
LOWER IN thailand0.166667
LOWER IN 1-month-old human stage0.166667
LOWER IN metronidazole0.142857
belgium0.125000
kingdom of denmark0.125000
LOWER IN rural community0.090909
crohn's disease0.083333
state of new york0.083333
1-year-old human stage0.066667
LOWER IN antibiotic0.062500
age0.047619
state of california0.038462
infant0.038462
LOWER IN male0.030303
homo sapiens0.029520
LOWER IN child0.027778
feces0.025478
adult0.023121
united states of america0.020243
female0.015873
LOWER IN control0.005405
control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
united states of america0.625000
adult0.500000
crohn's disease0.125000
LOWER IN control0.125000
belgium0.125000
usa born0.125000
LOWER IN non usa born0.125000
hispanic or latin american0.125000
LOWER IN child0.125000
toronto0.125000
control0.125000
LOWER IN antibiotic0.125000
LOWER IN vancomycin0.125000
LOWER IN metronidazole0.125000
LOWER IN neomycin0.125000
state of california0.125000
LOWER IN thailand0.125000
LOWER IN rural community0.125000
female0.125000
LOWER IN male0.125000
caucasian0.125000
european0.125000
LOWER IN asian0.125000
state of new york0.125000
age0.125000
1-year-old human stage0.125000
LOWER IN 1-month-old human stage0.125000
infant0.125000
kingdom of denmark0.125000

Problems / suggestions? Please email info AT dbbact DOT org