Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGAAAATAAGTCTGTTTTAAAAGTGCGGGGCTCAACCCCGTGATGGAATGGAAACTGTTTTTCTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
crohn's disease0.200000
usa born0.181818
LOWER IN non usa born0.181818
toronto0.166667
LOWER IN asian0.166667
hispanic or latin american0.153846
LOWER IN neomycin0.153846
caucasian0.153846
european0.153846
LOWER IN vancomycin0.142857
LOWER IN 1-month-old human stage0.133333
LOWER IN metronidazole0.125000
LOWER IN thailand0.125000
belgium0.117647
kingdom of denmark0.111111
LOWER IN rural community0.090909
state of new york0.090909
LOWER IN antibiotic0.074074
1-year-old human stage0.074074
age0.066667
homo sapiens0.060403
state of california0.055556
adult0.051282
infant0.051282
feces0.050847
united states of america0.044776
human adult stage0.043478
LOWER IN child0.041667
LOWER IN male0.037736
female0.026667
LOWER IN control0.020101
control0.010050
Fraction of dbbact annotations with this term covered by the query
TermScore
usa born0.500000
LOWER IN non usa born0.500000
toronto0.333333
LOWER IN asian0.333333
hispanic or latin american0.250000
LOWER IN neomycin0.250000
caucasian0.250000
european0.250000
LOWER IN vancomycin0.200000
LOWER IN 1-month-old human stage0.166667
crohn's disease0.142857
LOWER IN metronidazole0.142857
LOWER IN thailand0.142857
belgium0.125000
kingdom of denmark0.111111
LOWER IN rural community0.076923
state of new york0.076923
LOWER IN antibiotic0.055556
1-year-old human stage0.055556
age0.047619
state of california0.037037
infant0.033333
homo sapiens0.031142
human adult stage0.027027
adult0.026882
feces0.026087
LOWER IN child0.025641
united states of america0.023166
LOWER IN male0.022727
female0.015152
LOWER IN control0.010526
control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
united states of america0.666667
adult0.555556
crohn's disease0.333333
LOWER IN control0.222222
human adult stage0.111111
belgium0.111111
usa born0.111111
LOWER IN non usa born0.111111
hispanic or latin american0.111111
LOWER IN child0.111111
toronto0.111111
control0.111111
LOWER IN antibiotic0.111111
LOWER IN vancomycin0.111111
LOWER IN metronidazole0.111111
LOWER IN neomycin0.111111
state of california0.111111
LOWER IN thailand0.111111
LOWER IN rural community0.111111
female0.111111
LOWER IN male0.111111
caucasian0.111111
european0.111111
LOWER IN asian0.111111
state of new york0.111111
age0.111111
1-year-old human stage0.111111
LOWER IN 1-month-old human stage0.111111
infant0.111111
kingdom of denmark0.111111
Exp. ID User ID Description Date Region Flag Sequences
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 19
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557

Problems / suggestions? Please email info AT dbbact DOT org