Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACCTTTAAGTGAGATGTGAAATACCCGAGCTCAACTTGGGTGCTGCATTTCAAACTGGAGGTCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
sus scrofa0.357143
pig0.357143
rural community0.255319
cecal content0.235294
weaned0.235294
age 4-7 weeks0.235294
corn and soybean diet0.235294
jiulong river0.235294
fujian province0.235294
age 5-13 years0.235294
chuquisaca department0.235294
forearm0.235294
tibet autonomous region0.210526
jiangxi province0.210526
depth 0.5m0.210526
arm0.210526
farm0.201342
bolivia0.190476
child0.150000
kebbi state0.133333
age 10-15 years0.133333
LOWER IN urinary schistosomiasis0.133333
LOWER IN schistosomiasis0.133333
LOWER IN tibetan pig0.133333
LOWER IN tibetan swine0.133333
hadza0.133333
heavy metal0.133333
populated place0.133333
jinhua city prefecture0.133333
jinhua pig0.133333
LOWER IN preweaned0.133333
LOWER IN suckling0.133333
LOWER IN age 2-4 weeks0.133333
LOWER IN mouth mucosa0.133333
china0.128114
nigeria0.125000
tanzania0.125000
brassica0.125000
brassica oleracea0.125000
hunter gatherer0.117647
upstream0.117647
LOWER IN downstream0.117647
river0.108108
dry season0.105263
LOWER IN wet season0.105263
LOWER IN mouth0.100000
fresh water0.081633
winter0.074074
LOWER IN feces0.071429
caecum0.070175
LOWER IN summer0.068966
city0.066667
skin0.065574
soil0.062500
rhizosphere0.050000
feces0.038573
water0.038095
homo sapiens0.036419
control0.015038
Fraction of dbbact annotations with this term covered by the query
TermScore
kebbi state0.500000
age 10-15 years0.500000
LOWER IN urinary schistosomiasis0.500000
LOWER IN schistosomiasis0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
hadza0.500000
heavy metal0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
age 5-13 years0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN mouth mucosa0.500000
nigeria0.333333
tibet autonomous region0.333333
sus scrofa0.333333
pig0.333333
jiangxi province0.333333
tanzania0.333333
depth 0.5m0.333333
arm0.333333
brassica0.333333
brassica oleracea0.333333
rural community0.285714
hunter gatherer0.250000
upstream0.250000
LOWER IN downstream0.250000
bolivia0.250000
dry season0.166667
LOWER IN wet season0.166667
LOWER IN mouth0.142857
farm0.136364
child0.111111
river0.083333
winter0.071429
china0.070588
LOWER IN feces0.066667
LOWER IN summer0.062500
city0.058824
fresh water0.055556
caecum0.045455
skin0.041667
soil0.039216
rhizosphere0.037037
water0.021739
feces0.020305
homo sapiens0.019355
control0.008333
Fraction of annotations for the query sequences containing the term
TermScore
china0.692308
feces0.384615
sus scrofa0.384615
pig0.384615
farm0.384615
homo sapiens0.307692
rural community0.230769
child0.230769
caecum0.153846
cecal content0.153846
tibet autonomous region0.153846
jiangxi province0.153846
weaned0.153846
age 4-7 weeks0.153846
corn and soybean diet0.153846
soil0.153846
river0.153846
water0.153846
fresh water0.153846
depth 0.5m0.153846
jiulong river0.153846
fujian province0.153846
age 5-13 years0.153846
bolivia0.153846
chuquisaca department0.153846
skin0.153846
arm0.153846
forearm0.153846
nigeria0.076923
kebbi state0.076923
age 10-15 years0.076923
control0.076923
LOWER IN urinary schistosomiasis0.076923
LOWER IN schistosomiasis0.076923
LOWER IN tibetan pig0.076923
LOWER IN tibetan swine0.076923
tanzania0.076923
hadza0.076923
hunter gatherer0.076923
dry season0.076923
LOWER IN wet season0.076923
winter0.076923
LOWER IN summer0.076923
heavy metal0.076923
city0.076923
populated place0.076923
upstream0.076923
LOWER IN downstream0.076923
jinhua city prefecture0.076923
jinhua pig0.076923
LOWER IN preweaned0.076923
LOWER IN suckling0.076923
LOWER IN age 2-4 weeks0.076923
LOWER IN feces0.076923
LOWER IN mouth mucosa0.076923
LOWER IN mouth0.076923
rhizosphere0.076923
brassica0.076923
brassica oleracea0.076923
Exp. ID User ID Description Date Region Flag Sequences
509amnon high in control compared to urinary schistosomiasis schistosomiasis in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 35
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885

Problems / suggestions? Please email info AT dbbact DOT org