Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTTAACTCGTGAACTGCATTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.306522
homo sapiens0.299145
adult0.271493
sus scrofa0.241379
pig0.241379
rural community0.241379
zoological garden0.188406
farm0.133929
child0.132597
gay0.130435
msm0.127660
homosexual0.127660
china0.121990
monkey0.120000
kingdom of spain0.116279
caecum0.103004
hiv infection0.100000
male0.099010
sweden0.094340
city0.086331
united states of america0.083383
india0.082816
LOWER IN united states of america0.082645
ethiopia0.081967
control0.072577
canada0.067797
tibet autonomous region0.067797
himalayas0.066667
chuquisaca department0.066667
como zoo0.066667
russia0.065574
thailand0.064516
nepal0.064516
age 5-13 years0.064516
jiangxi province0.064516
msw0.062500
heterosexual0.062500
bolivia0.062500
obsolete_juvenile stage0.060606
state of minnesota0.058824
LOWER IN heterosexual0.051724
LOWER IN msw0.051724
papio anubis0.051502
olive baboon0.051502
taiwan0.050847
taipei city0.050847
hunter gatherer0.050847
small village0.050847
jiulong river0.050847
fujian province0.050847
gorilla gorilla0.050209
female0.049587
africa0.049587
LOWER IN crohn's disease0.049587
depth 0.5m0.049587
pregnancy0.048387
ileum0.047809
rectum0.047244
united kingdom0.043165
colon0.042705
river0.040541
skin0.039344
fresh water0.035503
toronto zoo0.034483
central african republic0.034483
bangui0.034483
low anterior resection0.034483
myanmar0.034483
karen0.034483
cameroon0.034483
kebbi state0.034483
age 10-15 years0.034483
preweaned0.034483
age 2-4 weeks0.034483
suckling0.034483
jinhua city prefecture0.034483
jinhua pig0.034483
LOWER IN finland0.034483
zambia0.034483
tunapuco0.034483
weaned0.034483
age 4-7 weeks0.034483
corn and soybean diet0.034483
theropithecus gelada0.034483
mongolian sheep0.034483
lincoln park zoo0.034483
chlorocebus aethiops0.034483
province of quebec0.033898
tonsil0.033898
amerindian0.033898
venezuela0.033898
nigeria0.033898
peru0.033898
chicago0.033898
wet season0.033898
LOWER IN dry season0.033898
LOWER IN mouth mucosa0.033898
state of colorado0.033613
LOWER IN city0.033613
cecal content0.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum1.333333
sus scrofa0.777778
pig0.777778
rural community0.777778
gay0.750000
LOWER IN heterosexual0.750000
LOWER IN msw0.750000
canada0.666667
papio anubis0.666667
olive baboon0.666667
tibet autonomous region0.666667
msm0.600000
homosexual0.600000
india0.571429
LOWER IN united states of america0.555556
zoological garden0.500000
toronto zoo0.500000
primary progressive multiple sclerosis0.500000
bihar state0.500000
LOWER IN kingdom of spain0.500000
rheumatoid arthritis0.500000
athlete0.500000
osteoarthritis0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
central african republic0.500000
bangui0.500000
taiwan0.500000
taipei city0.500000
raji0.500000
chepang0.500000
lima0.500000
shantytown0.500000
age 6-10 weeks0.500000
chuquisaca department0.500000
age 12-19 weeks0.500000
low anterior resection0.500000
hunter gatherer0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
denver0.500000
myanmar0.500000
karen0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
cameroon0.500000
ngoantet0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
yaounde0.500000
el salvador0.500000
small village0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
como zoo0.500000
white-faced saki0.500000
pithecia pithecia0.500000
age 130.500000
LOWER IN finland0.500000
village0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
age 1-20.500000
LOWER IN age 0-10.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
bangladesh0.500000
tunapuco0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
theropithecus gelada0.500000
ethiopia0.500000
LOWER IN hmong0.500000
mongolian sheep0.500000
cecum0.500000
jiulong river0.500000
fujian province0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
populated place0.500000
lincoln park zoo0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.839286
homo sapiens0.625000
adult0.375000
china0.169643
united states of america0.169643
sus scrofa0.142857
pig0.142857
rural community0.142857
zoological garden0.116071
farm0.107143
child0.107143
control0.098214
male0.089286
kingdom of spain0.089286
sweden0.089286
msm0.071429
gay0.071429
homosexual0.071429
monkey0.071429
hiv infection0.062500
city0.053571
caecum0.053571
india0.044643
LOWER IN united states of america0.044643
ethiopia0.044643
canada0.035714
female0.035714
russia0.035714
msw0.035714
heterosexual0.035714
tibet autonomous region0.035714
thailand0.035714
nepal0.035714
himalayas0.035714
age 5-13 years0.035714
bolivia0.035714
chuquisaca department0.035714
obsolete_juvenile stage0.035714
jiangxi province0.035714
state of minnesota0.035714
como zoo0.035714
pregnancy0.026786
skin0.026786
papio anubis0.026786
olive baboon0.026786
LOWER IN control0.026786
africa0.026786
taiwan0.026786
taipei city0.026786
hunter gatherer0.026786
LOWER IN heterosexual0.026786
LOWER IN msw0.026786
small village0.026786
LOWER IN crohn's disease0.026786
gorilla gorilla0.026786
rectum0.026786
ileum0.026786
colon0.026786
river0.026786
water0.026786
fresh water0.026786
depth 0.5m0.026786
jiulong river0.026786
fujian province0.026786
united kingdom0.026786
province of quebec0.017857
captive0.017857
toronto zoo0.017857
south korea0.017857
tibetan plateau0.017857
central african republic0.017857
bangui0.017857
tonsil0.017857
state of michigan0.017857
low anterior resection0.017857
amerindian0.017857
venezuela0.017857
state of colorado0.017857
myanmar0.017857
karen0.017857
cecal content0.017857
cameroon0.017857
egypt0.017857
nigeria0.017857
kebbi state0.017857
age 10-15 years0.017857
preweaned0.017857
age 2-4 weeks0.017857
suckling0.017857
jinhua city prefecture0.017857
jinhua pig0.017857
LOWER IN finland0.017857
zambia0.017857
wild0.017857
infant0.017857
peru0.017857
tunapuco0.017857
weaned0.017857
age 4-7 weeks0.017857
corn and soybean diet0.017857
Exp. ID User ID Description Date Region Flag Sequences
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 12
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 13
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
565amnondominant skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 16
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens russia adult 2020-01-05v3No1 / 17
574amnondominant feces, homo sapiens, russia, adult2020-01-05v3No1 / 19
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 20
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org