Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTTAACTCGTGAACTGCATTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
sus scrofa0.318182
pig0.318182
rural community0.281124
homo sapiens0.271246
feces0.270042
adult0.209217
farm0.180723
child0.179104
monkey0.157895
china0.116667
LOWER IN united states of america0.113636
ethiopia0.111111
caecum0.106195
tibet autonomous region0.093023
city0.092308
thailand0.090909
himalayas0.090909
india0.090909
age 5-13 years0.090909
chuquisaca department0.090909
nepal0.086957
jiangxi province0.086957
bolivia0.083333
obsolete_juvenile stage0.080000
united states of america0.072448
africa0.069767
taiwan0.069767
taipei city0.069767
hunter gatherer0.069767
small village0.069767
jiulong river0.069767
fujian province0.069767
zoological garden0.068571
LOWER IN crohn's disease0.067416
depth 0.5m0.067416
ileum0.065217
rectum0.064171
control0.060000
united kingdom0.056075
colon0.055300
river0.051724
gay0.048193
homosexual0.048193
msm0.048193
LOWER IN heterosexual0.048193
LOWER IN msw0.048193
central african republic0.047619
bangui0.047619
low anterior resection0.047619
myanmar0.047619
karen0.047619
cecal content0.047619
kebbi state0.047619
age 10-15 years0.047619
preweaned0.047619
age 2-4 weeks0.047619
suckling0.047619
jinhua city prefecture0.047619
jinhua pig0.047619
LOWER IN finland0.047619
zambia0.047619
tunapuco0.047619
weaned0.047619
age 4-7 weeks0.047619
corn and soybean diet0.047619
theropithecus gelada0.047619
mongolian sheep0.047619
chlorocebus aethiops0.047619
LOWER IN mouth mucosa0.047619
female0.046875
province of quebec0.046512
tonsil0.046512
amerindian0.046512
venezuela0.046512
nigeria0.046512
peru0.046512
LOWER IN city0.046512
wet season0.046512
LOWER IN dry season0.046512
state of colorado0.045977
LOWER IN duodenum0.045455
left colon0.045455
fresh water0.044776
tibetan plateau0.044444
egypt0.044444
state of tennessee0.044444
right colon0.044444
pregnancy0.043478
ovis aries0.043478
state of michigan0.042553
LOWER IN mouth0.042553
infant0.040816
wild0.038462
canada0.037037
water0.027523
tharu0.024390
agrarian0.024390
raji0.024390
chepang0.024390
lima0.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.777778
pig0.777778
rural community0.714286
tibet autonomous region0.666667
gay0.666667
homosexual0.666667
msm0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
LOWER IN united states of america0.625000
thailand0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
africa0.500000
central african republic0.500000
bangui0.500000
taiwan0.500000
taipei city0.500000
india0.500000
raji0.500000
chepang0.500000
lima0.500000
shantytown0.500000
age 6-10 weeks0.500000
age 5-13 years0.500000
chuquisaca department0.500000
age 12-19 weeks0.500000
low anterior resection0.500000
hunter gatherer0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
denver0.500000
myanmar0.500000
karen0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
el salvador0.500000
small village0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
age 130.500000
LOWER IN finland0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
papio anubis0.500000
olive baboon0.500000
theropithecus gelada0.500000
ethiopia0.500000
LOWER IN hmong0.500000
mongolian sheep0.500000
cecum0.500000
jiulong river0.500000
fujian province0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
populated place0.500000
cron diet0.500000
macaque0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.800000
homo sapiens0.612500
adult0.275000
sus scrofa0.200000
pig0.200000
china0.200000
rural community0.175000
farm0.150000
child0.150000
united states of america0.137500
monkey0.100000
control0.075000
caecum0.075000
city0.062500
LOWER IN united states of america0.062500
ethiopia0.062500
tibet autonomous region0.050000
thailand0.050000
nepal0.050000
himalayas0.050000
india0.050000
age 5-13 years0.050000
bolivia0.050000
chuquisaca department0.050000
obsolete_juvenile stage0.050000
jiangxi province0.050000
female0.037500
africa0.037500
taiwan0.037500
taipei city0.037500
hunter gatherer0.037500
small village0.037500
LOWER IN crohn's disease0.037500
zoological garden0.037500
rectum0.037500
ileum0.037500
colon0.037500
river0.037500
water0.037500
fresh water0.037500
depth 0.5m0.037500
jiulong river0.037500
fujian province0.037500
united kingdom0.037500
canada0.025000
province of quebec0.025000
pregnancy0.025000
tibetan plateau0.025000
LOWER IN control0.025000
central african republic0.025000
bangui0.025000
tonsil0.025000
state of michigan0.025000
low anterior resection0.025000
amerindian0.025000
venezuela0.025000
state of colorado0.025000
gay0.025000
homosexual0.025000
msm0.025000
LOWER IN heterosexual0.025000
LOWER IN msw0.025000
myanmar0.025000
karen0.025000
cecal content0.025000
egypt0.025000
nigeria0.025000
kebbi state0.025000
age 10-15 years0.025000
preweaned0.025000
age 2-4 weeks0.025000
suckling0.025000
jinhua city prefecture0.025000
jinhua pig0.025000
LOWER IN finland0.025000
zambia0.025000
wild0.025000
infant0.025000
peru0.025000
tunapuco0.025000
weaned0.025000
age 4-7 weeks0.025000
corn and soybean diet0.025000
theropithecus gelada0.025000
state of tennessee0.025000
mongolian sheep0.025000
ovis aries0.025000
LOWER IN duodenum0.025000
chlorocebus aethiops0.025000
LOWER IN city0.025000
right colon0.025000
left colon0.025000
wet season0.025000
LOWER IN dry season0.025000
LOWER IN mouth mucosa0.025000
LOWER IN mouth0.025000
low bmi0.012500
LOWER IN high bmi0.012500
czech republic0.012500
hiv infection0.012500
Exp. ID User ID Description Date Region Flag Sequences
470amnonhighfreq sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org