Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.486806
homo sapiens0.457854
adult0.356111
china0.160850
control0.154667
zoological garden0.144828
monkey0.143713
rural community0.135849
united states of america0.134720
child0.133874
pig0.132752
sus scrofa0.124908
macaca mulatta0.102564
female0.100214
kingdom of spain0.090173
rumen0.085934
research facility0.073544
city0.072289
captive0.066298
pregnancy0.060560
gorilla gorilla0.055249
rhesus macaque0.054054
caecum0.053440
obsolete_juvenile stage0.053333
farm0.053156
israel0.050955
msm0.047244
homosexual0.047244
india0.047133
low bmi0.046912
LOWER IN crohn's disease0.046875
ruminal fluid0.046693
indian rhesus macaque0.046693
cayo santiago0.046693
chimpanzee0.046693
puerto rico0.044610
female organism0.044610
male0.041379
small village0.039735
gay0.039735
age 5-13 years0.039604
tibetan plateau0.038462
obesity0.038462
italy0.037736
ovis aries0.037736
infant0.037175
thailand0.036364
united kingdom0.036364
wild0.035088
sweden0.032258
hunter gatherer0.031957
cameroon0.031873
alpine meadow0.031621
peru0.031621
tanzania0.031621
africa0.031621
age > 1 year0.031621
chuquisaca department0.031621
age 10-15 years0.031621
como zoo0.031621
pan troglodytes0.031621
ethiopia0.031621
LOWER IN infant0.031496
LOWER IN high bmi0.031373
yak0.031128
LOWER IN child0.031128
rectum0.030968
bos grunniens0.030651
belgium0.030651
bolivia0.030651
adult organism0.030651
LOWER IN wild0.030496
hiv infection0.030189
state of tennessee0.030189
age0.030075
colon0.029304
state of minnesota0.029304
canada0.029304
state of california0.028881
skin0.027682
age 30-500.024048
venezuela0.024048
amerindian0.024048
tibet autonomous region0.024048
central african republic0.024048
nanchang city prefecture0.024048
pan troglodytes troglodytes0.024048
papio anubis0.024048
equus asinus africanus0.024048
pemba island0.023904
nigeria0.023904
himalayas0.023904
colombia0.023904
age 4-10 years0.023904
LOWER IN age < 1 year0.023904
nouabale-ndoki national park0.023904
republic of congo0.023904
zambia0.023904
europe0.023904
guangzhou city prefecture0.023762
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
gorilla gorilla0.833333
small village0.750000
hunter gatherer0.750000
gay0.750000
pig0.687500
age 30-500.666667
venezuela0.666667
amerindian0.666667
LOWER IN obsolete_juvenile stage0.666667
tibet autonomous region0.666667
age 19-240.666667
cameroon0.666667
msm0.666667
homosexual0.666667
central african republic0.666667
age 5-13 years0.666667
metabolic syndrome0.666667
nanchang city prefecture0.666667
village0.666667
pan troglodytes troglodytes0.666667
papio anubis0.666667
olive baboon0.666667
equus asinus africanus0.666667
donkey0.666667
india0.625000
sus scrofa0.625000
monkey0.600000
low bmi0.555556
LOWER IN crohn's disease0.545455
alpine meadow0.500000
ruminal fluid0.500000
LOWER IN systemic lupus erythematosus0.500000
LOWER IN acquired immunodeficiency syndrome0.500000
bihar state0.500000
LOWER IN diarrhea0.500000
peru0.500000
teenager0.500000
age 9-17 years0.500000
age 1-3 years0.500000
tanzania0.500000
pemba island0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
nigeria0.500000
santa catarina state0.500000
municipality of yogyakarta0.500000
indonesia0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
caribbean latino0.500000
LOWER IN insomnia0.500000
age 1-18 years0.500000
sri lanka0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
antiretroviral therapy0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
raute0.500000
colombia0.500000
africa0.500000
bangui0.500000
municipality of reus0.500000
sesame allergy0.500000
age 4-10 years0.500000
quito0.500000
novosibirsk0.500000
denver0.500000
LOWER IN age 2-4 years0.500000
raji0.500000
metabolic syndrome x0.500000
LOWER IN iga igg negative fraction0.500000
LOWER IN iga negative fraction0.500000
iga positive fraction0.500000
milk allergy0.500000
hmong0.500000
azerbaijan0.500000
age 2-5 years0.500000
third trimester0.500000
LOWER IN usa born0.500000
non usa born0.500000
LOWER IN sesame allergy0.500000
lima0.500000
shantytown0.500000
age > 1 year0.500000
indian rhesus macaque0.500000
macaca mulatta0.500000
cayo santiago0.500000
age 60-790.500000
chuquisaca department0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
shuar population0.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
gaz:000521000.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.857143
homo sapiens0.653061
adult0.379592
united states of america0.208163
china0.167347
control0.142857
child0.085714
zoological garden0.085714
monkey0.081633
research facility0.077551
rural community0.073469
pig0.073469
female0.069388
sus scrofa0.069388
macaca mulatta0.057143
kingdom of spain0.053061
rumen0.048980
city0.040816
captive0.040816
pregnancy0.032653
caecum0.032653
farm0.032653
israel0.028571
male0.028571
italy0.028571
obsolete_juvenile stage0.028571
rhesus macaque0.028571
gorilla gorilla0.028571
ruminal fluid0.024490
low bmi0.024490
india0.024490
msm0.024490
homosexual0.024490
indian rhesus macaque0.024490
cayo santiago0.024490
puerto rico0.024490
LOWER IN crohn's disease0.024490
female organism0.024490
chimpanzee0.024490
tibetan plateau0.020408
small village0.020408
sweden0.020408
thailand0.020408
gay0.020408
obesity0.020408
age 5-13 years0.020408
united kingdom0.020408
infant0.020408
wild0.020408
ovis aries0.020408
bos grunniens0.016327
yak0.016327
alpine meadow0.016327
hunter gatherer0.016327
LOWER IN infant0.016327
LOWER IN high bmi0.016327
peru0.016327
tanzania0.016327
hiv infection0.016327
colon0.016327
belgium0.016327
cameroon0.016327
africa0.016327
LOWER IN child0.016327
state of california0.016327
age > 1 year0.016327
bolivia0.016327
chuquisaca department0.016327
age 10-15 years0.016327
age0.016327
state of minnesota0.016327
como zoo0.016327
canada0.016327
rectum0.016327
adult organism0.016327
state of tennessee0.016327
skin0.016327
pan troglodytes0.016327
LOWER IN wild0.016327
ethiopia0.016327
guangzhou city prefecture0.012245
age 30-500.012245
venezuela0.012245
amerindian0.012245
amsterdam0.012245
kingdom of the netherlands0.012245
hispanic or latin american0.012245
pemba island0.012245
msw0.012245
heterosexual0.012245
tibet autonomous region0.012245
nigeria0.012245
nepal0.012245
himalayas0.012245
colombia0.012245
central african republic0.012245
food allergy0.012245
age 4-10 years0.012245
nanchang city prefecture0.012245
poland0.012245
Exp. ID User ID Description Date Region Flag Sequences
561amnondominant bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 3
707amnon high in control compared to systemic lupus erythematosus in guangzhou city prefecture age 30-50 adult female china homo sapiens feces 2028-04-11v3No1 / 19
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
629amnon high in control compared to acquired immunodeficiency syndrome hiv infection in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 34
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 42
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
736amnoncommon age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
803amnoncommon type 2 diabetes mellitus, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
707amnoncommon guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to age 2-4 years child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
803amnoncommon control, commonwealth of massachusetts, age 50-80 years, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 100
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
770amnon high in vagina female organism compared to male organism penis in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 138
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
620amnoncommon chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 238
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 242
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
561amnon high in grass growth diet summer compared to spring green stage diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
649amnon high in jejunum duodenum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 295
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 330
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
729amnoncommon wild, cameroon, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 336
666amnoncommon horse, equus caballus, italy, feces2020-09-25v3No1 / 341
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
666amnoncommon donkey, equus asinus, equus asinus africanus, feces, italy2020-09-25v3No1 / 450
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 478
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
666amnoncommon equus asinus africanus, african wild ass, feces, italy2020-09-25v3No1 / 683
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
666amnoncommon italy, feces, wild horse, equus ferus2020-09-25v3No1 / 715
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org