Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCAGCAAGTCAGAAGTGAAATCTCTGGGCTCAACCCAGAAACTGCTTTTGAAACTGTTGCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
LOWER IN crohn's disease0.200000
homo sapiens0.178931
united kingdom0.163265
canada0.162162
feces0.144248
adult0.139027
captive0.122449
lima0.114286
shantytown0.114286
glasgow0.114286
age 130.114286
african lion safari0.114286
age 30-500.114286
age 60-790.114286
chuquisaca department0.114286
zoological garden0.109091
low bmi0.108108
LOWER IN child0.108108
age 5-13 years0.108108
LOWER IN high bmi0.105263
juvenile organism0.102564
LOWER IN ileum0.102564
left colon0.102564
bolivia0.102564
right colon0.097561
control0.094524
caecum0.093750
finland0.088889
rural community0.088889
sus scrofa0.081633
pig0.081633
kingdom of spain0.078431
obsolete_juvenile stage0.078431
city0.061538
LOWER IN irritable bowel syndrome0.060606
LOWER IN india0.060606
LOWER IN el salado0.060606
bangladesh0.060606
angus steer0.060606
LOWER IN days 14-280.060606
LOWER IN short bowel syndrome0.060606
red kangaroo0.060606
macropus rufus0.060606
cron diet0.060606
sigmoid colon0.060606
children0.060606
LOWER IN age 3-60.060606
LOWER IN age 8-120.060606
LOWER IN arm0.060606
LOWER IN forearm0.060606
age >940.060606
LOWER IN age 19-240.060606
LOWER IN soldiers0.060606
toronto zoo0.060606
eland0.060606
tragelaphus oryx0.060606
LOWER IN mouth mucosa0.060606
LOWER IN obsolete_juvenile stage0.058824
state of texas0.058824
giraffe0.058824
state of georgia0.058824
post-weaning0.058824
days 1-20.058824
caloric restriction diet0.058824
LOWER IN american diet0.058824
terminal ileum0.058824
LOWER IN jejunum0.058824
LOWER IN small village0.057143
LOWER IN diarrhea0.057143
giraffa camelopardalis0.057143
LOWER IN age < 1 year0.057143
skin0.056604
child0.056338
body mass index0.055556
LOWER IN infant0.055556
biopsy0.055556
czech republic0.054054
india0.054054
LOWER IN skin0.054054
LOWER IN ulcerative colitis0.052632
belgium0.052632
cow0.052632
LOWER IN mouth0.052632
kingdom of norway0.051282
LOWER IN duodenum0.051282
rectum0.050000
united states of america0.048044
bos taurus0.047619
LOWER IN colon0.044444
colon0.040000
diet0.036364
china0.019512
Fraction of dbbact annotations with this term covered by the query
TermScore
lima0.500000
shantytown0.500000
LOWER IN irritable bowel syndrome0.500000
glasgow0.500000
age 130.500000
LOWER IN india0.500000
LOWER IN el salado0.500000
bangladesh0.500000
african lion safari0.500000
canada0.500000
angus steer0.500000
LOWER IN days 14-280.500000
LOWER IN short bowel syndrome0.500000
red kangaroo0.500000
macropus rufus0.500000
cron diet0.500000
sigmoid colon0.500000
children0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
toronto zoo0.500000
eland0.500000
tragelaphus oryx0.500000
LOWER IN mouth mucosa0.500000
LOWER IN crohn's disease0.444444
low bmi0.333333
LOWER IN obsolete_juvenile stage0.333333
LOWER IN child0.333333
state of texas0.333333
giraffe0.333333
state of georgia0.333333
post-weaning0.333333
days 1-20.333333
caloric restriction diet0.333333
LOWER IN american diet0.333333
terminal ileum0.333333
age 5-13 years0.333333
LOWER IN jejunum0.333333
LOWER IN high bmi0.285714
juvenile organism0.250000
LOWER IN ileum0.250000
LOWER IN small village0.250000
LOWER IN diarrhea0.250000
giraffa camelopardalis0.250000
LOWER IN age < 1 year0.250000
left colon0.250000
bolivia0.250000
united kingdom0.222222
body mass index0.200000
LOWER IN infant0.200000
biopsy0.200000
right colon0.200000
captive0.166667
czech republic0.166667
india0.166667
LOWER IN skin0.166667
finland0.142857
LOWER IN ulcerative colitis0.142857
belgium0.142857
cow0.142857
rural community0.142857
LOWER IN mouth0.142857
kingdom of norway0.125000
zoological garden0.125000
LOWER IN duodenum0.125000
rectum0.111111
sus scrofa0.111111
pig0.111111
homo sapiens0.100629
kingdom of spain0.100000
obsolete_juvenile stage0.100000
bos taurus0.090909
caecum0.090909
adult0.088608
feces0.079208
LOWER IN colon0.071429
city0.058824
control0.056452
colon0.052632
child0.050000
diet0.041667
skin0.040000
united states of america0.026882
china0.011494
Fraction of annotations for the query sequences containing the term
TermScore
feces0.806452
homo sapiens0.806452
adult0.322581
control0.290323
united states of america0.225806
LOWER IN crohn's disease0.129032
united kingdom0.129032
captive0.096774
zoological garden0.096774
canada0.096774
skin0.096774
caecum0.096774
low bmi0.064516
LOWER IN high bmi0.064516
lima0.064516
city0.064516
shantytown0.064516
kingdom of spain0.064516
glasgow0.064516
LOWER IN child0.064516
obsolete_juvenile stage0.064516
age 130.064516
juvenile organism0.064516
finland0.064516
LOWER IN ileum0.064516
african lion safari0.064516
age 30-500.064516
age 60-790.064516
china0.064516
sus scrofa0.064516
pig0.064516
right colon0.064516
left colon0.064516
child0.064516
age 5-13 years0.064516
bolivia0.064516
rural community0.064516
chuquisaca department0.064516
LOWER IN irritable bowel syndrome0.032258
LOWER IN obsolete_juvenile stage0.032258
LOWER IN india0.032258
kingdom of norway0.032258
LOWER IN colon0.032258
LOWER IN ulcerative colitis0.032258
state of texas0.032258
LOWER IN el salado0.032258
LOWER IN small village0.032258
belgium0.032258
bangladesh0.032258
LOWER IN diarrhea0.032258
giraffe0.032258
giraffa camelopardalis0.032258
bos taurus0.032258
cow0.032258
state of georgia0.032258
post-weaning0.032258
angus steer0.032258
days 1-20.032258
LOWER IN days 14-280.032258
czech republic0.032258
LOWER IN short bowel syndrome0.032258
body mass index0.032258
red kangaroo0.032258
macropus rufus0.032258
cron diet0.032258
caloric restriction diet0.032258
LOWER IN american diet0.032258
diet0.032258
LOWER IN infant0.032258
LOWER IN age < 1 year0.032258
india0.032258
rectum0.032258
terminal ileum0.032258
sigmoid colon0.032258
colon0.032258
biopsy0.032258
children0.032258
LOWER IN age 3-60.032258
LOWER IN age 8-120.032258
LOWER IN skin0.032258
LOWER IN arm0.032258
LOWER IN forearm0.032258
age >940.032258
LOWER IN age 19-240.032258
LOWER IN soldiers0.032258
toronto zoo0.032258
eland0.032258
tragelaphus oryx0.032258
LOWER IN duodenum0.032258
LOWER IN jejunum0.032258
LOWER IN mouth mucosa0.032258
LOWER IN mouth0.032258
Exp. ID User ID Description Date Region Flag Sequences
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org