Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCAGCAAGTCAGAAGTGAAATCTCTGGGCTCAACCCAGAAACTGCTTTTGAAACTGTTGCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
LOWER IN crohn's disease0.216216
homo sapiens0.190567
united kingdom0.173913
feces0.150291
adult0.149573
lima0.125000
shantytown0.125000
glasgow0.125000
age 130.125000
age 30-500.125000
age 60-790.125000
chuquisaca department0.125000
age 5-13 years0.125000
low bmi0.117647
LOWER IN child0.117647
LOWER IN high bmi0.114286
juvenile organism0.111111
LOWER IN ileum0.111111
left colon0.111111
bolivia0.111111
right colon0.105263
caecum0.100840
control0.100159
finland0.095238
rural community0.095238
sus scrofa0.086957
pig0.086957
kingdom of spain0.083333
obsolete_juvenile stage0.083333
LOWER IN irritable bowel syndrome0.066667
LOWER IN india0.066667
LOWER IN el salado0.066667
bangladesh0.066667
LOWER IN days 14-280.066667
angus steer0.066667
LOWER IN short bowel syndrome0.066667
cron diet0.066667
sigmoid colon0.066667
children0.066667
LOWER IN age 3-60.066667
LOWER IN age 8-120.066667
LOWER IN forearm0.066667
LOWER IN arm0.066667
age >940.066667
LOWER IN age 19-240.066667
LOWER IN soldiers0.066667
LOWER IN mouth mucosa0.066667
city0.064516
child0.064516
LOWER IN obsolete_juvenile stage0.064516
state of texas0.064516
days 1-20.064516
post-weaning0.064516
state of georgia0.064516
caloric restriction diet0.064516
LOWER IN american diet0.064516
terminal ileum0.064516
LOWER IN jejunum0.064516
LOWER IN small village0.062500
LOWER IN diarrhea0.062500
LOWER IN age < 1 year0.062500
czech republic0.060606
body mass index0.060606
LOWER IN infant0.060606
biopsy0.060606
belgium0.058824
cow0.058824
india0.058824
LOWER IN skin0.058824
LOWER IN ulcerative colitis0.057143
LOWER IN duodenum0.057143
LOWER IN mouth0.057143
kingdom of norway0.055556
rectum0.054054
bos taurus0.052632
united states of america0.049751
LOWER IN colon0.048780
colon0.043478
diet0.039216
china0.020408
Fraction of dbbact annotations with this term covered by the query
TermScore
lima0.500000
shantytown0.500000
LOWER IN irritable bowel syndrome0.500000
glasgow0.500000
age 130.500000
LOWER IN india0.500000
LOWER IN el salado0.500000
bangladesh0.500000
LOWER IN days 14-280.500000
angus steer0.500000
LOWER IN short bowel syndrome0.500000
cron diet0.500000
sigmoid colon0.500000
children0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN mouth mucosa0.500000
LOWER IN crohn's disease0.444444
low bmi0.333333
LOWER IN obsolete_juvenile stage0.333333
LOWER IN child0.333333
state of texas0.333333
days 1-20.333333
post-weaning0.333333
state of georgia0.333333
caloric restriction diet0.333333
LOWER IN american diet0.333333
terminal ileum0.333333
LOWER IN jejunum0.333333
LOWER IN high bmi0.285714
juvenile organism0.250000
LOWER IN ileum0.250000
LOWER IN small village0.250000
LOWER IN diarrhea0.250000
LOWER IN age < 1 year0.250000
left colon0.250000
bolivia0.250000
united kingdom0.222222
czech republic0.200000
body mass index0.200000
LOWER IN infant0.200000
biopsy0.200000
right colon0.200000
belgium0.166667
cow0.166667
india0.166667
LOWER IN skin0.166667
finland0.142857
LOWER IN ulcerative colitis0.142857
rural community0.142857
LOWER IN duodenum0.142857
LOWER IN mouth0.142857
kingdom of norway0.125000
rectum0.111111
sus scrofa0.111111
pig0.111111
homo sapiens0.106667
kingdom of spain0.100000
obsolete_juvenile stage0.100000
bos taurus0.100000
caecum0.095238
adult0.094595
feces0.082051
LOWER IN colon0.076923
control0.059322
city0.058824
child0.058824
colon0.055556
diet0.043478
united states of america0.027624
china0.011905
Fraction of annotations for the query sequences containing the term
TermScore
feces0.892857
homo sapiens0.892857
adult0.357143
control0.321429
united states of america0.250000
LOWER IN crohn's disease0.142857
united kingdom0.142857
caecum0.107143
low bmi0.071429
LOWER IN high bmi0.071429
lima0.071429
city0.071429
shantytown0.071429
kingdom of spain0.071429
glasgow0.071429
LOWER IN child0.071429
obsolete_juvenile stage0.071429
age 130.071429
juvenile organism0.071429
finland0.071429
LOWER IN ileum0.071429
china0.071429
age 30-500.071429
age 60-790.071429
sus scrofa0.071429
pig0.071429
right colon0.071429
left colon0.071429
chuquisaca department0.071429
rural community0.071429
bolivia0.071429
age 5-13 years0.071429
child0.071429
LOWER IN irritable bowel syndrome0.035714
LOWER IN obsolete_juvenile stage0.035714
LOWER IN india0.035714
kingdom of norway0.035714
LOWER IN colon0.035714
LOWER IN ulcerative colitis0.035714
state of texas0.035714
LOWER IN el salado0.035714
LOWER IN small village0.035714
belgium0.035714
bangladesh0.035714
LOWER IN diarrhea0.035714
LOWER IN days 14-280.035714
days 1-20.035714
angus steer0.035714
post-weaning0.035714
state of georgia0.035714
cow0.035714
bos taurus0.035714
LOWER IN short bowel syndrome0.035714
czech republic0.035714
body mass index0.035714
cron diet0.035714
caloric restriction diet0.035714
LOWER IN american diet0.035714
diet0.035714
india0.035714
LOWER IN infant0.035714
LOWER IN age < 1 year0.035714
rectum0.035714
terminal ileum0.035714
sigmoid colon0.035714
colon0.035714
biopsy0.035714
children0.035714
LOWER IN age 3-60.035714
LOWER IN age 8-120.035714
LOWER IN forearm0.035714
LOWER IN arm0.035714
LOWER IN skin0.035714
age >940.035714
LOWER IN age 19-240.035714
LOWER IN soldiers0.035714
LOWER IN duodenum0.035714
LOWER IN jejunum0.035714
LOWER IN mouth mucosa0.035714
LOWER IN mouth0.035714
Exp. ID User ID Description Date Region Flag Sequences
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in angus steer post-weaning state of georgia united states of america feces cow bos taurus )2019-06-11v4No1 / 325
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org