Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
pig0.357767
sus scrofa0.350237
gallus gallus0.291096
chicken0.274678
macaca mulatta0.228628
caecum0.168324
research facility0.164087
monkey0.161435
china0.141002
farm0.136290
italy0.133929
ileum0.132701
zoological garden0.119403
feces0.117820
captive0.115464
female organism0.113014
jejunum0.103986
puerto rico0.096257
rhesus macaque0.096257
adult0.094932
indian rhesus macaque0.086486
cayo santiago0.086486
adult organism0.085308
female0.085063
broiler chicken0.084063
united kingdom0.080321
canada0.078853
pregnancy0.078560
united states of america0.077170
cobb broiler chicken0.076503
age 35 days0.073684
duodenum0.070234
age 30 days0.067416
homo sapiens0.066861
belgium0.066298
vagina0.062827
epidermis0.062176
skin0.061617
state of michigan0.060302
province of ontario0.058537
papio anubis0.056657
dairy0.055866
tonsil0.053619
male0.051414
river0.050251
age 7 weeks0.046243
wuhan0.046243
olive baboon0.045714
obsolete_juvenile stage0.045662
ismailia0.045198
jinzhou city prefecture0.045198
age 10-15 years0.045198
hen0.045198
age 8 months0.045198
age 25-45 years0.044199
cecal content0.043716
ovis aries0.042735
state of tennessee0.042328
male organism0.042328
rectal swab0.042328
city0.041885
egypt0.041451
jiangxi province0.041451
commonwealth of pennsylvania0.038278
LOWER IN caecum0.037915
colon0.037209
biofilm0.036199
fish feed0.034582
age 1 month0.034582
sweden0.034335
lincoln park zoo0.034286
fermented cocoa mass0.034286
time 5 days0.034286
state of tabasco0.034286
cocoa mass0.034286
theobroma cacao0.034286
age 20 months0.034286
preweaned0.034286
age 2-4 weeks0.034286
suckling0.034286
jiulong river0.034286
intestinal contents0.033994
chicago0.033708
province of alberta0.033708
fujian province0.033708
depth (soil) 50cm0.033149
state of washington0.032609
hawaii0.032609
age 1 week0.032609
small intestine0.032086
age 6 weeks0.032086
state of oregon0.032086
juvenile organism0.031579
rumen0.031250
mexico0.030612
rectum0.029703
LOWER IN wild0.028846
infant0.028037
LOWER IN state of california0.024000
age 4-7 years0.023392
Fraction of dbbact annotations with this term covered by the query
TermScore
age 4-7 years1.000000
age 7 weeks1.000000
wuhan1.000000
jejunal mucosa1.000000
lumen of jejunum1.000000
punta licosa1.000000
lizard1.000000
podarcis siculus1.000000
LOWER IN licosa island1.000000
sus scrofa0.875000
pig0.875000
macaca mulatta0.714286
age 30 days0.666667
papio anubis0.666667
olive baboon0.666667
fish feed0.666667
age 1 month0.666667
milan0.666667
gallus gallus0.526316
dairy0.500000
cobb broiler chicken0.500000
chicken0.500000
non-pregnant0.500000
ismailia0.500000
jinzhou city prefecture0.500000
red pepper sauce0.500000
lincoln park zoo0.500000
torso0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
pregnancy trimester 20.500000
fermented cocoa mass0.500000
time 5 days0.500000
state of tabasco0.500000
cocoa mass0.500000
theobroma cacao0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
age 10-15 years0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
puerto rico0.500000
age 20 months0.500000
LOWER IN before hsct0.500000
hematopoietic stem cell transplant0.500000
after hcst0.500000
late pregnancy0.500000
sus scrofa domesticus0.500000
upper leg skin0.500000
inner thigh0.500000
age 42 weeks0.500000
jinghong-10.500000
hen0.500000
early pregnancy0.500000
belgium0.500000
mustela putorius furo0.500000
ferret0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
age 60 weeks0.500000
municipality of yogyakarta0.500000
indonesia0.500000
fifth decade human stage0.500000
gut content0.500000
12c0.500000
cold environment0.500000
age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
tiger0.500000
panthera tigris0.500000
LOWER IN high wellfare feed0.500000
upper eyelid0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
chinstrap penguin0.500000
pygoscelis antarcticus0.500000
palm of hand0.500000
palmar part of manus0.500000
age 1-3 weeks0.500000
xinxiang city prefecture0.500000
skimmed milk powder0.500000
milk powder0.500000
age > 1 year0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
age 6 months0.500000
rhesus macaque0.500000
sparus aurata0.500000
seabream0.500000
open water pond0.500000
ria formosa0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
nida basin0.500000
herbivorous beetle0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.384615
research facility0.313609
united states of america0.230769
pig0.224852
china0.224852
sus scrofa0.218935
gallus gallus0.201183
chicken0.189349
adult0.147929
macaca mulatta0.136095
homo sapiens0.130178
caecum0.130178
monkey0.106509
farm0.106509
italy0.088757
ileum0.082840
captive0.082840
zoological garden0.076923
female0.071006
canada0.065089
female organism0.065089
male0.059172
jejunum0.059172
united kingdom0.059172
adult organism0.053254
puerto rico0.053254
rhesus macaque0.053254
skin0.047337
pregnancy0.047337
broiler chicken0.047337
indian rhesus macaque0.047337
cayo santiago0.047337
duodenum0.041420
age 35 days0.041420
cobb broiler chicken0.041420
age 30 days0.035503
vagina0.035503
province of ontario0.035503
epidermis0.035503
belgium0.035503
state of michigan0.035503
ovis aries0.029586
obsolete_juvenile stage0.029586
dairy0.029586
papio anubis0.029586
tonsil0.029586
river0.029586
olive baboon0.023669
age 25-45 years0.023669
ismailia0.023669
egypt0.023669
jinzhou city prefecture0.023669
state of tennessee0.023669
male organism0.023669
cecal content0.023669
sweden0.023669
age 10-15 years0.023669
rectal swab0.023669
age 7 weeks0.023669
wuhan0.023669
colon0.023669
commonwealth of pennsylvania0.023669
hen0.023669
jiangxi province0.023669
LOWER IN caecum0.023669
city0.023669
age 8 months0.023669
biofilm0.023669
small intestine0.017751
lincoln park zoo0.017751
chicago0.017751
fermented cocoa mass0.017751
time 5 days0.017751
state of tabasco0.017751
mexico0.017751
cocoa mass0.017751
theobroma cacao0.017751
age 6 weeks0.017751
province of alberta0.017751
fish feed0.017751
age 20 months0.017751
state of washington0.017751
juvenile organism0.017751
rectum0.017751
hawaii0.017751
age 1 month0.017751
preweaned0.017751
age 2-4 weeks0.017751
suckling0.017751
intestinal contents0.017751
age 1 week0.017751
control0.017751
infant0.017751
rumen0.017751
LOWER IN state of california0.017751
state of oregon0.017751
water0.017751
fresh water0.017751
depth (soil) 50cm0.017751
jiulong river0.017751
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
744amnondominant ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 9
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
724amnondominant non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 10
780amnondominant jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 10
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 11
717amnondominant chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 11
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
935amnondominant monkey, age 4-7 years, female organism, olive baboon, captive, state of oklahoma, papio anubis, united states of america, feces2022-09-18v4No1 / 12
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant fermented cocoa mass, time 5 days, state of tabasco, mexico, cocoa mass, theobroma cacao)2021-06-01v3No1 / 12
840amnondominant china, broiler chicken, gallus gallus, ileum, farm2021-11-08v3No1 / 12
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
785amnondominant state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 13
604amnondominant caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
876amnondominant age 20 months, monkey, state of washington, macaca mulatta, juvenile organism, research facility, united states of america, feces2022-03-06v4No1 / 14
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
568amnondominant gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 15
655amnon high in hematopoietic stem cell transplant after hcst compared to before hsct in italy feces homo sapiens 2020-09-13v3No1 / 15
934amnondominant age 7 weeks, wuhan, china, jejunal mucosa, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
934amnondominant age 7 weeks, wuhan, china, lumen of jejunum, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 16
717amnondominant upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 16
904amnondominant age 42 weeks, jinghong-1, hen, china, chicken, gallus gallus, caecum, research facility2022-05-18v3No1 / 16
673amnondominant caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
724amnoncommon non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 17
776amnondominant caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 17
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 18
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
744amnondominant cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 18
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 20
666amnondominant canis lupus familiaris, dog, italy, feces2020-09-25v3No1 / 20
805amnon high in nicotine dependence cigarette smoking smoker compared to non-smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 20
818amnondominant ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 20
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
744amnondominant caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 21
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 23
717amnon high in female organism female compared to male organism male in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 23
738amnondominant caecum, age 1 week, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 23
723amnondominant municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 24
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
785amnoncommon state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 26
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
789amnoncommon in traditionally harvested cocoa pulp after fementation (common fermented cocoa mass, time 5 days, state of tabasco, mexico, cocoa mass, theobroma cacao)2021-06-01v3No1 / 35
744amnoncommon ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 38
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
666amnoncommon tiger, panthera tigris, italy, feces2020-09-25v3No1 / 43
738amnon high in standard feed compared to high wellfare feed in caecum age 1 week united kingdom chicken gallus gallus 2021-01-30v3No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in state of tabasco mexico cocoa mass theobroma cacao )2021-06-01v3No1 / 43
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 47
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 56
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 56
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 57
770amnoncommon age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 59
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
738amnoncommon caecum, age 1 week, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 64
840amnoncommon farm, china, ileum, broiler chicken, gallus gallus2021-11-08v3No1 / 67
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
770amnoncommon age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
934amnoncommon lumen of jejunum, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 73
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
904amnoncommon age 42 weeks, research facility, china, jinghong-1, hen, caecum, gallus gallus, chicken2022-05-18v3No1 / 89
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
888amnoncommon cow milk based food product, skimmed milk powder, milk powder, ireland, milk2022-03-30v3No1 / 105
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
744amnoncommon cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 114
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
744amnon high in ileum compared to caecum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 121
934amnoncommon jejunal mucosa, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 127
782amnon high in gill compared to skin in sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 132
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
744amnoncommon caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 141
780amnon high in jejunum duodenum small intestine compared to caecum in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 153
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in gill open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 174
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v3No1 / 174
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
604amnoncommon caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 185
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
776amnoncommon caecum, wild, feral, age 15-20 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 191
738amnoncommon caecum, age 30 days, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 202
878amnoncommon pm10, respirable suspended particulate matter, city, municipality of beijing, china, air2022-03-11v3No1 / 203
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
696amnon high in georissa georissa similis compared to alycaeus jagori in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 282
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
780amnoncommon caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 294
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
927amnoncommon punta licosa, lizard, podarcis siculus, italy, feces2022-08-15v3No1 / 305
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
776amnoncommon caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 343
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 356
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v4No1 / 363
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
876amnoncommon feces, age 20 months, juvenile organism, state of washington, united states of america, research facility, monkey, macaca mulatta2022-03-06v4No1 / 364
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 364
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
935amnoncommon monkey, age 4-7 years, female organism, olive baboon, captive, state of oklahoma, papio anubis, united states of america, feces2022-09-18v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
927amnon high in punta licosa compared to licosa island in lizard podarcis siculus italy feces 2022-08-15v3No1 / 509
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
671amnon high in age 8 months compared to 3-month-old human stage age 6 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
876amnon high in age 20 months juvenile organism compared to age 1 week neonate in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 1065
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common biofilm, river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org