Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
digestive system0.358491
oncorhynchus mykiss0.289855
rainbow trout0.289855
sweden0.233010
infant0.221130
fish0.192308
southern united states0.169492
snake0.156250
research facility0.149737
larvae insect diet0.140351
frog0.137143
age 1 year0.131148
osteopilus septentrionalis0.112150
ursus arctos0.109091
brown bear0.109091
LOWER IN fishmeal diet0.109091
colon0.107623
india0.100840
feces0.100671
skin0.096774
homo sapiens0.091650
LOWER IN adult0.090909
state of florida0.087591
australia0.083916
periplaneta americana0.076923
gryllinae0.075472
field cricket0.075472
oslo0.075472
coluber constrictor0.075472
eastern racer snake0.075472
LOWER IN pre pupae insect diet0.075472
defatted larvae insect diet0.075472
age 3-60.075472
populus0.075472
LOWER IN age 30-500.075472
LOWER IN age 60-790.075472
LOWER IN tadpole0.074074
age < 3 years0.072727
wild0.070588
LOWER IN wild0.070175
midgut0.067797
age < 1 year0.067797
russia0.067797
state of tennessee0.067797
tree0.067797
united states of america0.065609
stem0.065574
adult0.064935
kingdom of norway0.061538
cultivated environment0.061538
china0.049834
state of california0.045977
heliconius sara0.039216
sara longwing butterfly0.039216
pantherophis obsoletus0.039216
black rat snake0.039216
arboreal snake0.039216
fossorial snake0.039216
storeria dekayi0.039216
ground snake0.039216
chemically defined diet0.039216
LOWER IN cat chow0.039216
LOWER IN age 30-400.039216
LOWER IN non c. diff diarrhea0.039216
quasipaa spinosa0.039216
giant spiny frog0.039216
LOWER IN age 2 months0.039216
LOWER IN defatted larvae insect diet0.039216
defatted larvae insects diet0.039216
liolaemus ruibali0.039216
LOWER IN age 8-120.039216
LOWER IN age 13-140.039216
aardvark0.039216
orycteropus afer0.039216
cambridgeshire0.039216
lissotriton vulgaris0.039216
aquatic snake0.039216
nerodia sipedon0.039216
northern water snake0.039216
pre-pupae insect diet0.039216
england0.039216
LOWER IN common carp0.039216
LOWER IN cyprinus carpio0.039216
LOWER IN estonia0.039216
pre pupae insect diet0.039216
dnbs induced colitis0.039216
populus deltoides0.039216
LOWER IN populus trichocarpa x deltoides0.039216
new delhi0.039216
age 8-120.039216
age >940.039216
termite0.039216
reticulitermes flaviceps0.039216
age one year0.039216
LOWER IN age one month0.039216
wild type0.039216
butterfly0.038462
jiangxi province0.038462
argentina0.038462
LOWER IN hindgut0.038462
Fraction of dbbact annotations with this term covered by the query
TermScore
osteopilus septentrionalis0.666667
periplaneta americana0.666667
heliconius sara0.500000
sara longwing butterfly0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
ursus arctos0.500000
brown bear0.500000
gryllinae0.500000
field cricket0.500000
chemically defined diet0.500000
LOWER IN cat chow0.500000
oslo0.500000
LOWER IN age 30-400.500000
coluber constrictor0.500000
eastern racer snake0.500000
LOWER IN non c. diff diarrhea0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
LOWER IN age 2 months0.500000
LOWER IN defatted larvae insect diet0.500000
defatted larvae insect diet0.500000
LOWER IN fishmeal diet0.500000
defatted larvae insects diet0.500000
liolaemus ruibali0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
aardvark0.500000
orycteropus afer0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
pre-pupae insect diet0.500000
england0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN estonia0.500000
pre pupae insect diet0.500000
dnbs induced colitis0.500000
populus0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
new delhi0.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age >940.500000
termite0.500000
reticulitermes flaviceps0.500000
age one year0.500000
LOWER IN age one month0.500000
wild type0.500000
frog0.428571
LOWER IN tadpole0.400000
butterfly0.333333
digestive system0.333333
snake0.333333
age 1 year0.333333
jiangxi province0.333333
argentina0.333333
LOWER IN hindgut0.333333
newt0.333333
age < 3 years0.333333
wistar rat0.333333
india0.285714
infant0.277778
LOWER IN wild0.250000
small intestine0.250000
LOWER IN small intestine0.250000
LOWER IN finland0.250000
sweden0.222222
midgut0.200000
age < 1 year0.200000
clostridium difficile intestinal infectious disease0.200000
russia0.200000
colitis0.200000
state of tennessee0.200000
tree0.200000
fish0.181818
LOWER IN adult0.176471
costa rica0.166667
hospital0.166667
hunan province0.166667
south africa0.166667
rattus0.166667
stem0.166667
LOWER IN leaf0.166667
kingdom of denmark0.166667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.408163
digestive system0.387755
research facility0.387755
homo sapiens0.306122
united states of america0.265306
sweden0.244898
fish0.204082
oncorhynchus mykiss0.204082
rainbow trout0.204082
infant0.183673
skin0.122449
snake0.102041
southern united states0.102041
china0.102041
adult0.102041
colon0.081633
age 1 year0.081633
frog0.081633
larvae insect diet0.081633
ursus arctos0.061224
brown bear0.061224
wild0.061224
australia0.061224
LOWER IN adult0.061224
india0.061224
LOWER IN fishmeal diet0.061224
osteopilus septentrionalis0.061224
state of florida0.061224
gryllinae0.040816
field cricket0.040816
midgut0.040816
kingdom of norway0.040816
oslo0.040816
age < 1 year0.040816
coluber constrictor0.040816
eastern racer snake0.040816
female0.040816
state of california0.040816
LOWER IN wild0.040816
LOWER IN control0.040816
LOWER IN pre pupae insect diet0.040816
defatted larvae insect diet0.040816
age 3-60.040816
age < 3 years0.040816
russia0.040816
LOWER IN tadpole0.040816
state of tennessee0.040816
populus0.040816
tree0.040816
stem0.040816
cultivated environment0.040816
LOWER IN age 30-500.040816
LOWER IN age 60-790.040816
periplaneta americana0.040816
costa rica0.020408
butterfly0.020408
heliconius sara0.020408
sara longwing butterfly0.020408
pantherophis obsoletus0.020408
black rat snake0.020408
arboreal snake0.020408
fossorial snake0.020408
storeria dekayi0.020408
ground snake0.020408
winter0.020408
LOWER IN summer0.020408
chemically defined diet0.020408
diet0.020408
LOWER IN cat chow0.020408
LOWER IN age 30-400.020408
hospital0.020408
clostridium difficile intestinal infectious disease0.020408
LOWER IN non c. diff diarrhea0.020408
diarrhea0.020408
hunan province0.020408
jiangxi province0.020408
quasipaa spinosa0.020408
giant spiny frog0.020408
crohn's disease0.020408
ulcerative colitis0.020408
LOWER IN age 2 months0.020408
LOWER IN defatted larvae insect diet0.020408
defatted larvae insects diet0.020408
liolaemus ruibali0.020408
argentina0.020408
small intestine0.020408
stomach0.020408
LOWER IN feces0.020408
LOWER IN hindgut0.020408
LOWER IN colon0.020408
LOWER IN age 8-120.020408
LOWER IN age 13-140.020408
zoological garden0.020408
south africa0.020408
aardvark0.020408
orycteropus afer0.020408
newt0.020408
cambridgeshire0.020408
lissotriton vulgaris0.020408
united kingdom0.020408
Exp. ID User ID Description Date Region Flag Sequences
501amnonhighfreq costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
536amnonhighfreq snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
536amnonhighfreq snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
324amnonhiger in crickets fed chemically defined diet compared to cat chow diet ( high in chemically defined diet diet compared to cat chow in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 19
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
536amnonhighfreq snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in hunan province jiangxi province quasipaa spinosa giant spiny frog frog colon digestive system china )2018-04-10v4No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
392amnon high in defatted larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 58
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
324amnoncommon australia, gryllinae, field cricket, midgut, colon, digestive system, research facility2018-04-27v4No1 / 79
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
416amnoncommon termite, reticulitermes flaviceps, colon, research facility, united states of america2018-11-30v4No1 / 511
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637

Problems / suggestions? Please email info AT dbbact DOT org