Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
digestive system0.342000
oncorhynchus mykiss0.277778
rainbow trout0.277778
sweden0.214286
infant0.208817
fish0.170940
southern united states0.161290
snake0.149254
research facility0.149254
larvae insect diet0.133333
frog0.130435
age 1 year0.121212
osteopilus septentrionalis0.106195
wild0.105820
ursus arctos0.103448
brown bear0.103448
colon0.103448
LOWER IN fishmeal diet0.103448
feces0.099927
india0.096000
skin0.090226
LOWER IN adult0.085714
homo sapiens0.084826
state of florida0.080537
united states of america0.078517
australia0.075949
periplaneta americana0.072727
gryllinae0.071429
field cricket0.071429
oslo0.071429
coluber constrictor0.071429
eastern racer snake0.071429
LOWER IN pre pupae insect diet0.071429
defatted larvae insect diet0.071429
age 3-60.071429
urocyon littoralis catalinae0.071429
santa catalina island fox0.071429
santa catalina island0.071429
urocyon littoralis0.071429
perianal skin0.071429
populus0.071429
LOWER IN age 30-500.071429
LOWER IN age 60-790.071429
adult0.070755
LOWER IN tadpole0.070175
age < 3 years0.068966
midgut0.064516
age < 1 year0.064516
LOWER IN wild0.064516
russia0.064516
state of tennessee0.064516
tree0.064516
stem0.060606
kingdom of norway0.058824
cultivated environment0.058824
rectum0.055556
state of california0.044444
china0.043732
heliconius sara0.037037
sara longwing butterfly0.037037
pantherophis obsoletus0.037037
black rat snake0.037037
arboreal snake0.037037
fossorial snake0.037037
storeria dekayi0.037037
ground snake0.037037
chemically defined diet0.037037
LOWER IN cat chow0.037037
LOWER IN age 30-400.037037
LOWER IN non c. diff diarrhea0.037037
quasipaa spinosa0.037037
giant spiny frog0.037037
LOWER IN age 2 months0.037037
LOWER IN defatted larvae insect diet0.037037
defatted larvae insects diet0.037037
liolaemus ruibali0.037037
LOWER IN age 8-120.037037
LOWER IN age 13-140.037037
aardvark0.037037
orycteropus afer0.037037
cambridgeshire0.037037
lissotriton vulgaris0.037037
aquatic snake0.037037
nerodia sipedon0.037037
northern water snake0.037037
pre-pupae insect diet0.037037
england0.037037
LOWER IN common carp0.037037
LOWER IN cyprinus carpio0.037037
LOWER IN estonia0.037037
pre pupae insect diet0.037037
dnbs induced colitis0.037037
populus deltoides0.037037
LOWER IN populus trichocarpa x deltoides0.037037
new delhi0.037037
age 8-120.037037
LOWER IN ear canal0.037037
LOWER IN external acoustic meatus0.037037
age >940.037037
termite0.037037
Fraction of dbbact annotations with this term covered by the query
TermScore
osteopilus septentrionalis0.666667
periplaneta americana0.666667
heliconius sara0.500000
sara longwing butterfly0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
ursus arctos0.500000
brown bear0.500000
gryllinae0.500000
field cricket0.500000
chemically defined diet0.500000
LOWER IN cat chow0.500000
oslo0.500000
LOWER IN age 30-400.500000
coluber constrictor0.500000
eastern racer snake0.500000
LOWER IN non c. diff diarrhea0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
LOWER IN age 2 months0.500000
LOWER IN defatted larvae insect diet0.500000
defatted larvae insect diet0.500000
LOWER IN fishmeal diet0.500000
defatted larvae insects diet0.500000
liolaemus ruibali0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
perianal skin0.500000
aardvark0.500000
orycteropus afer0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
aquatic snake0.500000
nerodia sipedon0.500000
northern water snake0.500000
pre-pupae insect diet0.500000
england0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN estonia0.500000
pre pupae insect diet0.500000
dnbs induced colitis0.500000
populus0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
new delhi0.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN ear canal0.500000
LOWER IN external acoustic meatus0.500000
age >940.500000
termite0.500000
reticulitermes flaviceps0.500000
age one year0.500000
LOWER IN age one month0.500000
wild type0.500000
frog0.428571
LOWER IN tadpole0.400000
butterfly0.333333
snake0.333333
jiangxi province0.333333
argentina0.333333
LOWER IN hindgut0.333333
newt0.333333
age < 3 years0.333333
wistar rat0.333333
digestive system0.321429
age 1 year0.285714
india0.285714
infant0.263158
small intestine0.250000
metronidazole0.250000
state of texas0.250000
LOWER IN small intestine0.250000
LOWER IN finland0.250000
sweden0.200000
midgut0.200000
age < 1 year0.200000
clostridium difficile intestinal infectious disease0.200000
LOWER IN wild0.200000
russia0.200000
colitis0.200000
state of tennessee0.200000
tree0.200000
LOWER IN adult0.166667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.403846
research facility0.384615
digestive system0.365385
united states of america0.307692
homo sapiens0.288462
sweden0.230769
fish0.192308
oncorhynchus mykiss0.192308
rainbow trout0.192308
infant0.173077
skin0.115385
adult0.115385
snake0.096154
southern united states0.096154
wild0.096154
china0.096154
colon0.076923
age 1 year0.076923
frog0.076923
larvae insect diet0.076923
ursus arctos0.057692
brown bear0.057692
australia0.057692
LOWER IN adult0.057692
india0.057692
LOWER IN control0.057692
LOWER IN fishmeal diet0.057692
osteopilus septentrionalis0.057692
state of florida0.057692
gryllinae0.038462
field cricket0.038462
midgut0.038462
kingdom of norway0.038462
oslo0.038462
age < 1 year0.038462
coluber constrictor0.038462
eastern racer snake0.038462
female0.038462
state of california0.038462
LOWER IN wild0.038462
LOWER IN pre pupae insect diet0.038462
defatted larvae insect diet0.038462
age 3-60.038462
urocyon littoralis catalinae0.038462
santa catalina island fox0.038462
santa catalina island0.038462
urocyon littoralis0.038462
perianal skin0.038462
rectum0.038462
age < 3 years0.038462
russia0.038462
LOWER IN tadpole0.038462
state of tennessee0.038462
populus0.038462
tree0.038462
stem0.038462
cultivated environment0.038462
LOWER IN age 30-500.038462
LOWER IN age 60-790.038462
periplaneta americana0.038462
costa rica0.019231
butterfly0.019231
heliconius sara0.019231
sara longwing butterfly0.019231
pantherophis obsoletus0.019231
black rat snake0.019231
arboreal snake0.019231
fossorial snake0.019231
storeria dekayi0.019231
ground snake0.019231
winter0.019231
LOWER IN summer0.019231
chemically defined diet0.019231
diet0.019231
LOWER IN cat chow0.019231
LOWER IN age 30-400.019231
hospital0.019231
clostridium difficile intestinal infectious disease0.019231
LOWER IN non c. diff diarrhea0.019231
diarrhea0.019231
hunan province0.019231
jiangxi province0.019231
quasipaa spinosa0.019231
giant spiny frog0.019231
crohn's disease0.019231
ulcerative colitis0.019231
LOWER IN age 2 months0.019231
LOWER IN defatted larvae insect diet0.019231
defatted larvae insects diet0.019231
liolaemus ruibali0.019231
argentina0.019231
small intestine0.019231
stomach0.019231
LOWER IN feces0.019231
LOWER IN hindgut0.019231
LOWER IN colon0.019231
LOWER IN age 8-120.019231
LOWER IN age 13-140.019231
zoological garden0.019231
south africa0.019231
Exp. ID User ID Description Date Region Flag Sequences
501amnondominant costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
536amnondominant snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 13
536amnondominant snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
387amnonhigh freq. in feces of wild brown bear (dominant ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
324amnonhiger in crickets fed chemically defined diet compared to cat chow diet ( high in chemically defined diet diet compared to cat chow in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 19
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
536amnondominant snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in hunan province jiangxi province quasipaa spinosa giant spiny frog frog colon digestive system china )2018-04-10v4No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
392amnon high in defatted larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 58
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
324amnoncommon australia, gryllinae, field cricket, midgut, colon, digestive system, research facility2018-04-27v4No1 / 79
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
416amnoncommon termite, reticulitermes flaviceps, colon, research facility, united states of america2018-11-30v4No1 / 511
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637

Problems / suggestions? Please email info AT dbbact DOT org