Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG
common ontology terms
term enrichment score
TermScore
feces0.509311
research facility0.313542
united states of america0.311013
homo sapiens0.277395
mus musculus0.214277
mouse0.203930
digestive system0.199234
butterfly0.183333
china0.165594
costa rica0.161943
adult0.124987
infant0.102564
LOWER IN control0.101296
child0.100000
female0.093089
farm0.082529
whole body0.080000
caecum0.071379
bird0.068085
obsolete_juvenile stage0.063348
india0.060521
high fat diet0.059849
larval stage0.058801
body proper0.058515
control0.058061
skin0.056698
mexico0.055944
gallus gallus0.055300
chicken0.055300
galapagos islands0.054795
finch0.054795
canis lupus familiaris0.054299
state of california0.052219
united kingdom0.050715
heliconius erato0.050459
tropical and subtropical moist broadleaf forest biome0.050459
panama0.049217
diet0.048703
beetle0.046620
dog0.045558
river0.045045
forest ecosystem0.042885
crohn's disease0.042105
rural community0.041885
male0.040678
colon0.040161
snake0.037559
monkey0.037488
zoological garden0.037441
c57bl/60.036866
rat0.036530
australia0.035242
hospital0.032980
ulcerative colitis0.032845
french republic0.032845
pig0.032818
sus scrofa0.032818
kingdom of denmark0.032710
food (fermented)0.032710
diarrhea0.032533
sprague dawley0.032533
balb/c0.032357
city0.031978
desert0.031927
fish0.031842
wild0.031674
sweden0.031674
water0.029264
ethiopia0.028436
age < 1 year0.028302
c57bl/6j0.028169
antibiotic0.027972
poland0.027778
obesity0.027778
age0.027473
leaf0.027473
texas0.027397
state of florida0.027273
fresh water0.027211
kingdom of spain0.025316
nigeria0.023725
liolaemus ruibali0.023585
small intestine0.023585
ant0.023585
carnivorous beetle0.023585
raba river0.023585
southern united states0.023585
new delhi0.023585
oncorhynchus mykiss0.023585
rainbow trout0.023585
commonwealth of virginia0.023447
argentina0.023310
duodenum0.023310
age < 3 years0.023310
rattus norvegicus0.023175
germany0.023130
stomach0.023041
intestine0.022975
subgingival plaque0.022779
oreochromis niloticus0.019048
Fraction of dbbact annotations with this term covered by the query
TermScore
india0.833333
mexico0.800000
ethiopia0.750000
metabolic syndrome0.666667
butterfly0.666667
metronidazole0.666667
age 2 months0.666667
hospital0.666667
oreochromis niloticus0.666667
beetle0.666667
snake0.666667
crohn's disease0.666667
nigeria0.666667
human contact0.666667
floor0.666667
dust0.666667
stream0.666667
LOWER IN c57bl/6j0.666667
osteopilus septentrionalis0.666667
whole plant0.666667
cactus0.666667
jiangxi province0.666667
post-weaning0.666667
periplaneta americana0.666667
high fat diet0.636364
monkey0.625000
gallus gallus0.600000
chicken0.600000
zoological garden0.600000
age < 1 year0.600000
clostridium difficile intestinal infectious disease0.600000
state of tennessee0.600000
colitis0.600000
mouse0.591837
ulcerative colitis0.571429
french republic0.571429
rural community0.571429
united kingdom0.555556
pig0.555556
sus scrofa0.555556
mus musculus0.553571
lymphoma0.500000
metabolic syndrome x0.500000
LOWER IN resistant starch type 4 diet0.500000
liolaemus ruibali0.500000
mixed0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
whole body0.500000
galapagos islands0.500000
finch0.500000
geospiza fortis0.500000
medium ground finch0.500000
geospiza scandens0.500000
common cactus finch0.500000
age 3 days0.500000
clindamycin0.500000
green warbler-finch0.500000
certhidea olivacea0.500000
costa rica0.500000
pareuptychia ocirrhoe0.500000
two-banded satyr butterfly0.500000
teneral adult0.500000
geospiza fuliginosa0.500000
small ground finch0.500000
urbanus teleus0.500000
caterpillar0.500000
frass0.500000
adelpha cytherea0.500000
smooth-banded sister butterfly0.500000
marpesia merops0.500000
vellore district0.500000
jordan0.500000
child0.500000
obsolete_juvenile stage0.500000
type i diabetes mellitus0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
geospiza difficilis0.500000
sharp-beaked ground finch0.500000
camarhynchus parvulus0.500000
small tree finch0.500000
marpesia petreus0.500000
ruddy daggerwing butterfly0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
mustela putorius furo0.500000
ferret0.500000
cithaerias pireta0.500000
blushing phantom butterfly0.500000
phoebis argante0.500000
apricot sulphur butterfly0.500000
aeria eurimedia0.500000
small intestine0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
c3h/hej0.500000
chagas disease0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.521739
united states of america0.287440
homo sapiens0.251208
research facility0.229469
mus musculus0.132850
digestive system0.125604
mouse0.123188
china0.113527
butterfly0.106280
costa rica0.096618
adult0.089372
LOWER IN control0.067633
infant0.057971
child0.055556
female0.053140
farm0.045894
whole body0.043478
caecum0.041063
bird0.038647
control0.038647
obsolete_juvenile stage0.033816
body proper0.031401
larval stage0.031401
india0.031401
high fat diet0.031401
skin0.031401
canis lupus familiaris0.028986
gallus gallus0.028986
chicken0.028986
galapagos islands0.028986
finch0.028986
state of california0.028986
mexico0.028986
diet0.026570
heliconius erato0.026570
panama0.026570
tropical and subtropical moist broadleaf forest biome0.026570
forest ecosystem0.026570
united kingdom0.026570
dog0.024155
beetle0.024155
river0.024155
male0.021739
crohn's disease0.021739
rural community0.021739
colon0.021739
zoological garden0.019324
c57bl/60.019324
snake0.019324
monkey0.019324
rat0.019324
australia0.019324
city0.016908
hospital0.016908
diarrhea0.016908
balb/c0.016908
kingdom of denmark0.016908
ulcerative colitis0.016908
wild0.016908
sprague dawley0.016908
sweden0.016908
french republic0.016908
desert0.016908
fish0.016908
food (fermented)0.016908
pig0.016908
sus scrofa0.016908
water0.016908
age0.014493
kingdom of spain0.014493
antibiotic0.014493
age < 1 year0.014493
texas0.014493
poland0.014493
obesity0.014493
ethiopia0.014493
c57bl/6j0.014493
state of florida0.014493
fresh water0.014493
leaf0.014493
liolaemus ruibali0.012077
stomach0.012077
argentina0.012077
small intestine0.012077
commonwealth of virginia0.012077
ant0.012077
carnivorous beetle0.012077
raba river0.012077
germany0.012077
subgingival plaque0.012077
southern united states0.012077
new delhi0.012077
rattus norvegicus0.012077
duodenum0.012077
nigeria0.012077
age < 3 years0.012077
intestine0.012077
oncorhynchus mykiss0.012077
rainbow trout0.012077
italy0.009662
Exp. ID User ID Description Date Region Flag Sequences
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 2
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 3
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, pupa, forest ecosystem2017-04-11v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 4
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 4
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
440amnoncommon galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 5
501amnonhighfreq costa rica, butterfly, digestive system, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v4No1 / 5
118amnoncommon in captive raised teneral adult butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, teneral adult, forest ecosystem)2017-04-11v4No1 / 6
118amnonhighfreq butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, pupa, forest ecosystem2017-04-11v4No1 / 6
440amnoncommon galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, urbanus teleus2019-03-08v4No1 / 6
118amnonhighfreq butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
501amnonhighfreq costa rica, butterfly, digestive system, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 7
501amnoncommon costa rica, butterfly, digestive system, marpesia merops2019-03-09v4No1 / 7
284amnon high in age 2 months compared to age 1 year in homo sapiens female feces state of california infant 2018-01-27v4No1 / 8
332amnoncommon homo sapiens, infant, vellore district, city, age 2 months, india2018-05-14v4No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
406amnonhighfreq feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnonhighfreq galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
501amnoncommon costa rica, butterfly, digestive system, marpesia petreus, ruddy daggerwing butterfly2019-03-08v4No1 / 8
501amnonhighfreq costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 8
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 8
118amnonhigh freq. in captive raised teneral adult butterfly (highfreq butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, teneral adult, forest ecosystem)2017-04-11v4No1 / 9
391amnoncommon feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 9
399amnonhighfreq feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
501amnonhighfreq costa rica, butterfly, digestive system, cithaerias pireta, blushing phantom butterfly2019-03-08v4No1 / 9
501amnoncommon costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v4No1 / 9
501amnonhighfreq costa rica, butterfly, digestive system, aeria eurimedia2019-03-09v4No1 / 9
71amnonhighfreq liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
78amnonhighfreq nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
501amnonhighfreq costa rica, butterfly, digestive system, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 10
501amnonhighfreq costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 10
501amnoncommon costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
302amnonhigh freq. in feces of canary pet birds (highfreq bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 11
391amnonhighfreq feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
501amnonhighfreq costa rica, butterfly, digestive system, dulcedo polita2019-03-08v4No1 / 11
501amnonhighfreq costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 11
501amnoncommon costa rica, butterfly, digestive system, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnonhighfreq costa rica, butterfly, digestive system, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnoncommon costa rica, butterfly, digestive system, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 11
501amnonhighfreq costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
89amnonhighfreq junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
118amnoncommon in captive reared butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v4No1 / 12
408amnonhighfreq ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 12
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 12
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 12
495amnonhighfreq gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
243amnonhighfreq beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 13
501amnonhighfreq costa rica, butterfly, digestive system, cissia terrestris2019-03-08v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
515amnonhighfreq poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 13
516amnonhighfreq homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
89amnonhighfreq junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
118amnoncommon in wild butterfly (common butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in butterfly heliconius erato panama tropical and subtropical moist broadleaf forest biome body proper whole body forest ecosystem 2017-04-11v4No1 / 14
220amnonhighfreq mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
408amnon high in larval stage compared to stomach in ant cephalotes costa rica united states of america 2018-11-22v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, cissia terrestris2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v4No1 / 14
501amnonhighfreq costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 14
336amnonhighfreq feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
339amnonhighfreq homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 15
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
440amnonhighfreq galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 15
501amnoncommon costa rica, butterfly, digestive system, taygetis laches2019-03-08v4No1 / 15
501amnoncommon costa rica, butterfly, digestive system, cithaerias pireta, blushing phantom butterfly2019-03-08v4No1 / 15
515amnonhighfreq whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 15
536amnonhighfreq snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
118amnonhigh freq. in wild butterfly (highfreq butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 16
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 16
352amnonhighfreq homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
407amnonhighfreq costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
408amnoncommon ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 16
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 16
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
212amnonhighfreq mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 17
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex gracilis, larval stage2018-11-22v4No1 / 17
428amnonhighfreq homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, dulcedo polita2019-03-08v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
39amnonhigh freq. in obsese lepr-db mice (highfreq mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
95amnonhigh freq. in root canal (highfreq homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 18
220amnonhighfreq mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v4No1 / 18
440amnonhighfreq galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
488amnonhighfreq canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
60amnonhighfreq anser cygnoides, feces, china2017-02-03v4No1 / 19
118amnonhigh freq. in captive reared butterfly (highfreq butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v4No1 / 19
121amnonhighfreq homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
489amnonhighfreq feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
292amnonhighfreq homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnonhighfreq homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
390amnonhighfreq homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 20
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
201amnonhigh freq. in cactus fly whole body (highfreq drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
340amnonhighfreq feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 25
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
515amnoncommon poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 25
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
165amnoncommon in house fly larva grown on moist wheat bran (common research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 29
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
71amnoncommon liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 33
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 33
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 36
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederidus ruficollis2019-04-18v4No1 / 45
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. gena in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 47
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
127amnoncommon gallus gallus, chicken, united states of america, caecum, age 14-28 days2017-04-14v4No1 / 51
324amnonlower in crickets fed chemically defined diet compared to cat chow diet ( high in cat chow diet compared to chemically defined diet in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 51
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces infant india )2016-12-19v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
281amnoncommon shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 59
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 68
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 4 days2019-03-03v4No1 / 69
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
324amnoncommon australia, gryllinae, field cricket, midgut, colon, digestive system, research facility2018-04-27v4No1 / 79
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 84
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
427amnoncommon united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, kingdom of spain, farm, age 2 weeks2019-03-03v4No1 / 134
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il1-alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
108amnoncommon research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
324amnoncommon australia, gryllinae, field cricket, midgut, colon, digestive system2018-04-27v4No1 / 168
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
423amnon high in human contact compared to no human contact chernobyl exclusion zone in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
495amnon high in control compared to typhlitis disease intestinal disease in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 412
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
283amnoncommon pycnoscelus surinamensis, cockroach, burrowing cockroach, research facility, kingdom of denmark, hindgut, digestive system2018-01-25v4No1 / 448
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 755
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
257amnoncommon in tilapia pond sediment (common sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 1179
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262

Problems / suggestions? Please email info AT dbbact DOT org