Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCTTCGGCTCAACCGAAGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sweden0.218182
oncorhynchus mykiss0.216867
rainbow trout0.216867
costa rica0.179775
fermented food product0.167331
butterfly0.162791
food product0.160000
fish0.157205
digestive system0.153110
coffea arabica0.109589
pre pupae insect diet0.109589
state of rhode island0.109589
ecuador0.103896
balb/c0.095238
homo sapiens0.093855
diet0.089552
china0.085837
ethiopian banana0.084507
ensete ventricosum0.084507
larvae insect diet0.084507
rural community0.079470
ethiopia0.077922
skin0.070796
feces0.069666
child0.066298
infant0.065217
high fat diet0.061224
wet processing0.057971
caligo atreus0.057971
yellow-edged giant owl butterfly0.057971
dry processing0.057971
zea mays subsp. mays0.057971
corn0.057971
early timepoint0.057971
red pepper sauce0.057971
LOWER IN defatted larvae insect diet0.057971
LOWER IN fishmeal diet0.057971
drosophila0.057971
drosophila nigrospiracula0.057971
fly0.057971
anaerobic fermentation0.057971
days 30-600.057971
age 8-120.057971
forearm0.057971
chuquisaca department0.057971
age 5-13 years0.057971
serofluid dish0.056338
jiangshui0.056338
whole plant0.056338
meat food product0.056338
capsicum annuum0.056338
age < 3 years0.056338
amerindian0.056338
venezuela0.056338
arm0.056338
russia0.054795
late timepoint0.054795
hunter gatherer0.054795
bolivia0.054795
research facility0.054089
mexico0.053333
wild0.052632
sichuan province0.051948
desert0.050633
LOWER IN adult0.048780
israel0.048193
sus scrofa0.048193
united kingdom0.048193
pig0.048193
united states of america0.048058
female0.044444
LOWER IN control0.032967
mouse0.032258
caligo brasiliensis0.029851
brazilian owl butterfly0.029851
lactobacillus plantarum0.029851
pseudodebis zimri0.029851
taygetis laches0.029851
ursus arctos0.029851
brown bear0.029851
archaeoprepona demophon0.029851
banded king shoemaker butterfly0.029851
fermented corn0.029851
days 2-300.029851
LOWER IN fresh corn0.029851
LOWER IN time 00.029851
fresh0.029851
LOWER IN late timpoint0.029851
LOWER IN food spoilage0.029851
days 1-150.029851
aerobic fermentation0.029851
spice product0.029851
spices0.029851
LOWER IN low salt concentration0.029851
high salt concentration0.029851
gut content0.029851
cold temperature habitat0.029851
temp 12c0.029851
LOWER IN warm temperature habitat0.029851
LOWER IN temp 18c0.029851
Fraction of dbbact annotations with this term covered by the query
TermScore
food product0.600000
coffea arabica0.500000
wet processing0.500000
caligo brasiliensis0.500000
brazilian owl butterfly0.500000
lactobacillus plantarum0.500000
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
pseudodebis zimri0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
pre pupae insect diet0.500000
taygetis laches0.500000
dry processing0.500000
ursus arctos0.500000
brown bear0.500000
archaeoprepona demophon0.500000
banded king shoemaker butterfly0.500000
zea mays subsp. mays0.500000
corn0.500000
fermented corn0.500000
days 2-300.500000
LOWER IN fresh corn0.500000
LOWER IN time 00.500000
fresh0.500000
early timepoint0.500000
LOWER IN late timpoint0.500000
LOWER IN food spoilage0.500000
days 1-150.500000
aerobic fermentation0.500000
ethiopian banana0.500000
ensete ventricosum0.500000
spice product0.500000
spices0.500000
LOWER IN low salt concentration0.500000
high salt concentration0.500000
red pepper sauce0.500000
LOWER IN defatted larvae insect diet0.500000
larvae insect diet0.500000
LOWER IN fishmeal diet0.500000
gut content0.500000
cold temperature habitat0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
isla palominos0.500000
acropora cervicornis0.500000
state of rhode island0.500000
red pepper0.500000
fish sauce0.500000
himalayas0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
drosophila0.500000
drosophila nigrospiracula0.500000
fly0.500000
LOWER IN sucram0.500000
standard feed0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
scallion0.500000
LOWER IN larvae insect diet0.500000
pre-pupae insect diet0.500000
LOWER IN estonia0.500000
LOWER IN low fat diet0.500000
anaerobic fermentation0.500000
days 30-600.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
LOWER IN cactus0.500000
LOWER IN decaying0.500000
low fat diet0.500000
age 3-60.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
food processing factory0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
LOWER IN aerobic fermentation0.500000
LOWER IN days 1-150.500000
age 30-500.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
forearm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
LOWER IN mouth mucosa0.500000
fermented food product0.375000
sweden0.375000
serofluid dish0.333333
jiangshui0.333333
ecuador0.333333
costa rica0.333333
Fraction of annotations for the query sequences containing the term
TermScore
digestive system0.246154
feces0.230769
research facility0.215385
homo sapiens0.215385
united states of america0.184615
china0.153846
sweden0.153846
fish0.138462
oncorhynchus mykiss0.138462
rainbow trout0.138462
costa rica0.123077
fermented food product0.107692
butterfly0.107692
diet0.092308
food product0.092308
mus musculus0.076923
mouse0.076923
female0.076923
balb/c0.076923
coffea arabica0.061538
ecuador0.061538
pre pupae insect diet0.061538
state of rhode island0.061538
skin0.061538
LOWER IN control0.046154
high fat diet0.046154
ethiopian banana0.046154
ensete ventricosum0.046154
ethiopia0.046154
larvae insect diet0.046154
infant0.046154
rural community0.046154
child0.046154
serofluid dish0.030769
jiangshui0.030769
wet processing0.030769
caligo atreus0.030769
yellow-edged giant owl butterfly0.030769
dry processing0.030769
wild0.030769
zea mays subsp. mays0.030769
corn0.030769
whole plant0.030769
israel0.030769
meat food product0.030769
early timepoint0.030769
sichuan province0.030769
capsicum annuum0.030769
red pepper sauce0.030769
LOWER IN defatted larvae insect diet0.030769
LOWER IN adult0.030769
LOWER IN fishmeal diet0.030769
adult0.030769
drosophila0.030769
drosophila nigrospiracula0.030769
fly0.030769
mexico0.030769
desert0.030769
sus scrofa0.030769
united kingdom0.030769
pig0.030769
age < 3 years0.030769
russia0.030769
anaerobic fermentation0.030769
days 30-600.030769
late timepoint0.030769
age 8-120.030769
amerindian0.030769
hunter gatherer0.030769
venezuela0.030769
forearm0.030769
arm0.030769
chuquisaca department0.030769
bolivia0.030769
age 5-13 years0.030769
caligo brasiliensis0.015385
brazilian owl butterfly0.015385
probiotics0.015385
lactobacillus plantarum0.015385
pseudodebis zimri0.015385
taygetis laches0.015385
ursus arctos0.015385
brown bear0.015385
winter0.015385
LOWER IN summer0.015385
archaeoprepona demophon0.015385
banded king shoemaker butterfly0.015385
fermented corn0.015385
days 2-300.015385
LOWER IN fresh corn0.015385
LOWER IN time 00.015385
fresh0.015385
LOWER IN late timpoint0.015385
LOWER IN food spoilage0.015385
days 1-150.015385
aerobic fermentation0.015385
monkey0.015385
cebus capucinus0.015385
white-faced capuchin0.015385
dry season0.015385
Exp. ID User ID Description Date Region Flag Sequences
91amnonhighfreq china, fermented food product, serofluid dish, jiangshui2017-03-08v4No1 / 9
67amnonhigh freq. in wet processing of coffee beans (highfreq coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
501amnoncommon costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 13
220amnonhighfreq mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
501amnonhighfreq costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 14
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, pre pupae insect diet2018-11-05v4No1 / 15
501amnoncommon costa rica, butterfly, digestive system, taygetis laches2019-03-08v4No1 / 15
67amnonhigh freq. in dry processing of coffee beans (highfreq coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 16
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 19
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china food product meat food product )2018-01-09v4No1 / 34
539amnoncommon days 1-15, aerobic fermentation, early timepoint, fermented food product, ethiopian banana, ensete ventricosum, ethiopia2019-07-31v4No1 / 35
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
74amnoncommon food product, spice product, spices, united states of america2017-02-27v4No1 / 39
547amnon high in high salt concentration compared to low salt concentration in sichuan province china capsicum annuum red pepper sauce fermented food product 2019-08-15v4No1 / 43
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
547amnoncommon sichuan province, china, capsicum annuum, red pepper sauce, fermented food product2019-08-15v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in cold temperature habitat temp 12c compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
549amnoncommon isla palominos, puerto rico, coral, acropora cervicornis2019-08-17v4No1 / 62
311amnoncommon food product, united states of america, state of rhode island, red pepper2018-04-09v4No1 / 63
311amnoncommon food product, united states of america, state of rhode island, fish sauce2018-04-09v4No1 / 68
91amnoncommon china, fermented food product, serofluid dish, jiangshui2017-03-08v4No1 / 70
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa united kingdom pig )2017-11-26v4No1 / 109
269amnoncommon in fresh yao meat food (common china, food product, meat food product)2018-01-09v4No1 / 113
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 116
311amnoncommon united states of america, state of rhode island, food product, scallion2018-04-09v4No1 / 121
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
539amnoncommon anaerobic fermentation, days 30-60, late timepoint, fermented food product, ethiopian banana, ensete ventricosum, ethiopia2019-07-31v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
539amnon high in late timepoint anaerobic fermentation days 30-60 compared to early timepoint aerobic fermentation days 1-15 in fermented food product ethiopian banana ensete ventricosum ethiopia 2019-07-31v4No1 / 510
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in forearm arm skin compared to feces in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org