Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCTTCGGCTCAACCGAAGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sweden0.206897
oncorhynchus mykiss0.204545
rainbow trout0.204545
costa rica0.170213
food (fermented)0.157895
butterfly0.153846
fish0.150628
foodon product type0.150000
digestive system0.149533
coffea arabica0.102564
pre pupae insect diet0.102564
state of rhode island0.102564
homo sapiens0.099912
ecuador0.093023
balb/c0.090909
skin0.089552
diet0.084507
china0.081967
ensete ventricosum0.078947
ethiopian banana0.078947
larvae insect diet0.078947
rural community0.074534
ethiopia0.073171
feces0.066574
belgium0.065934
infant0.061856
child0.060000
high fat diet0.058252
wet processing0.054054
caligo atreus0.054054
yellow-edged giant owl butterfly0.054054
dry processing0.054054
zea mays subsp. mays0.054054
corn0.054054
early timepoint0.054054
red pepper sauce0.054054
LOWER IN defatted larvae insect diet0.054054
LOWER IN fishmeal diet0.054054
drosophila0.054054
drosophila nigrospiracula0.054054
fly0.054054
LOWER IN sinusitis0.054054
LOWER IN chronic rhinosinusitis0.054054
days 30-600.054054
anaerobic fermentation0.054054
age 8-120.054054
chuquisaca department0.054054
forearm0.054054
research facility0.053571
serofluid dish0.052632
jiangshui0.052632
whole plant0.052632
capsicum annuum0.052632
age < 3 years0.052632
amerindian0.052632
venezuela0.052632
age 5-13 years0.052632
arm0.052632
russia0.051282
late timepoint0.051282
hunter gatherer0.051282
bolivia0.051282
mexico0.050000
pair of nares0.050000
adult0.049587
bos taurus0.049383
wild0.048780
sichuan province0.048780
desert0.047619
nasopharynx0.046512
united states of america0.046476
LOWER IN adult0.045977
israel0.045455
sus scrofa0.045455
pig0.045455
united kingdom0.045455
farm0.043011
female0.042553
mouse0.031746
LOWER IN control0.031088
mus musculus0.028571
caligo brasiliensis0.027778
brazilian owl butterfly0.027778
lactobacillus plantarum0.027778
pseudodebis zimri0.027778
taygetis laches0.027778
ursus arctos0.027778
brown bear0.027778
archaeoprepona demophon0.027778
banded king shoemaker butterfly0.027778
fermented corn0.027778
days 2-300.027778
LOWER IN fresh corn0.027778
LOWER IN time 00.027778
fresh0.027778
LOWER IN late timpoint0.027778
LOWER IN food spoilage0.027778
aerobic fermentation0.027778
days 1-150.027778
LOWER IN anterior naris0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
foodon product type0.600000
coffea arabica0.500000
wet processing0.500000
caligo brasiliensis0.500000
brazilian owl butterfly0.500000
lactobacillus plantarum0.500000
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
pseudodebis zimri0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
pre pupae insect diet0.500000
taygetis laches0.500000
dry processing0.500000
ursus arctos0.500000
brown bear0.500000
archaeoprepona demophon0.500000
banded king shoemaker butterfly0.500000
zea mays subsp. mays0.500000
corn0.500000
fermented corn0.500000
days 2-300.500000
LOWER IN fresh corn0.500000
LOWER IN time 00.500000
fresh0.500000
early timepoint0.500000
LOWER IN late timpoint0.500000
LOWER IN food spoilage0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
LOWER IN anterior naris0.500000
spices0.500000
spice or herb0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
LOWER IN defatted larvae insect diet0.500000
larvae insect diet0.500000
LOWER IN fishmeal diet0.500000
gut content0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
cold environment0.500000
acropora cervicornis0.500000
isla palominos0.500000
state of rhode island0.500000
red pepper0.500000
fish sauce0.500000
himalayas0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
drosophila0.500000
drosophila nigrospiracula0.500000
fly0.500000
LOWER IN sucram0.500000
standard feed0.500000
LOWER IN sinusitis0.500000
LOWER IN chronic rhinosinusitis0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
scallion0.500000
LOWER IN larvae insect diet0.500000
pre-pupae insect diet0.500000
LOWER IN estonia0.500000
LOWER IN low fat diet0.500000
days 30-600.500000
anaerobic fermentation0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
anterior naris0.500000
LOWER IN cactus0.500000
LOWER IN decaying0.500000
low fat diet0.500000
male0.500000
age 3-60.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
canada0.500000
food processing factory0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
LOWER IN days 1-150.500000
LOWER IN aerobic fermentation0.500000
age 30-500.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
chuquisaca department0.500000
forearm0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
LOWER IN mouth mucosa0.500000
food (fermented)0.375000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.242857
digestive system0.228571
feces0.214286
research facility0.200000
united states of america0.171429
china0.142857
sweden0.142857
fish0.128571
oncorhynchus mykiss0.128571
rainbow trout0.128571
costa rica0.114286
food (fermented)0.100000
butterfly0.100000
diet0.085714
foodon product type0.085714
mus musculus0.071429
mouse0.071429
female0.071429
balb/c0.071429
adult0.071429
skin0.071429
coffea arabica0.057143
ecuador0.057143
pre pupae insect diet0.057143
state of rhode island0.057143
LOWER IN control0.042857
high fat diet0.042857
ethiopia0.042857
ensete ventricosum0.042857
ethiopian banana0.042857
belgium0.042857
larvae insect diet0.042857
infant0.042857
rural community0.042857
control0.042857
child0.042857
serofluid dish0.028571
jiangshui0.028571
wet processing0.028571
caligo atreus0.028571
yellow-edged giant owl butterfly0.028571
dry processing0.028571
wild0.028571
zea mays subsp. mays0.028571
corn0.028571
whole plant0.028571
israel0.028571
early timepoint0.028571
nasopharynx0.028571
red pepper sauce0.028571
capsicum annuum0.028571
sichuan province0.028571
LOWER IN defatted larvae insect diet0.028571
LOWER IN adult0.028571
LOWER IN fishmeal diet0.028571
drosophila0.028571
drosophila nigrospiracula0.028571
fly0.028571
mexico0.028571
desert0.028571
sus scrofa0.028571
pig0.028571
united kingdom0.028571
LOWER IN sinusitis0.028571
LOWER IN chronic rhinosinusitis0.028571
age < 3 years0.028571
russia0.028571
late timepoint0.028571
days 30-600.028571
anaerobic fermentation0.028571
age 8-120.028571
pair of nares0.028571
amerindian0.028571
hunter gatherer0.028571
venezuela0.028571
bos taurus0.028571
farm0.028571
age 5-13 years0.028571
bolivia0.028571
chuquisaca department0.028571
arm0.028571
forearm0.028571
contaminant0.014286
contamination0.014286
caligo brasiliensis0.014286
brazilian owl butterfly0.014286
probiotics0.014286
lactobacillus plantarum0.014286
pseudodebis zimri0.014286
taygetis laches0.014286
ursus arctos0.014286
brown bear0.014286
winter0.014286
LOWER IN summer0.014286
archaeoprepona demophon0.014286
banded king shoemaker butterfly0.014286
fermented corn0.014286
days 2-300.014286
LOWER IN fresh corn0.014286
LOWER IN time 00.014286
Exp. ID User ID Description Date Region Flag Sequences
277amnonhigher in blanks compared to nasopharynx (contamination)2019-12-05v4No1 / 5
91amnonhighfreq serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 9
67amnonhigh freq. in wet processing of coffee beans (highfreq coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
501amnoncommon costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 13
220amnonhighfreq mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
501amnonhighfreq costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 14
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, pre pupae insect diet2018-11-05v4No1 / 15
501amnoncommon costa rica, butterfly, digestive system, taygetis laches2019-03-08v4No1 / 15
67amnonhigh freq. in dry processing of coffee beans (highfreq coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 16
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 19
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china foodon product type )2018-01-09v4No1 / 34
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
567amnon high in nasopharynx compared to pair of nares anterior naris in belgium adult homo sapiens 2019-12-05v4No1 / 38
74amnoncommon spices, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 39
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
201amnoncommon in cactus fly whole body (common drosophila, drosophila nigrospiracula, fly, mexico, desert, body proper)2017-10-01v4No1 / 101
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
567amnon high in control compared to sinusitis chronic rhinosinusitis in nasopharynx belgium adult homo sapiens 2019-12-05v4No1 / 114
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 116
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org