Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGTGTAGGCGGGACTTCAAGTCAGATGTGAAAATTGCGGGCTCAACCCGCAACCTGCATTTGAAACTGAGGTTCTTGAGAGTCGGAGAGGTAAATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
rural community0.317881
monkey0.202020
feces0.168788
homo sapiens0.158968
child0.140000
LOWER IN crohn's disease0.125000
adult0.122628
africa0.122449
LOWER IN child0.122449
cameroon0.100000
pemba island0.097561
small village0.097561
taipei city0.097561
low anterior resection0.097561
age 60-790.097561
chuquisaca department0.097561
age 30-500.093023
age 5-13 years0.093023
LOWER IN city0.090909
tanzania0.088889
taiwan0.088889
ethiopia0.088889
bolivia0.088889
LOWER IN united states of america0.085106
thailand0.081633
zoological garden0.076923
male0.051948
helminthiasis0.051282
LOWER IN stunted growth0.051282
LOWER IN age 2-4 years0.051282
indonesia0.051282
municipality of yogyakarta0.051282
kebbi state0.051282
LOWER IN plant diet0.051282
yaounde0.051282
nouabale-ndoki national park0.051282
republic of congo0.051282
LOWER IN eastern chimpanzee0.051282
central chimpanzee0.051282
LOWER IN pan troglodytes verus0.051282
LOWER IN europe0.051282
karen0.051282
myanmar0.051282
LOWER IN hmong0.051282
suckling0.051282
preweaned0.051282
age 2-4 weeks0.051282
LOWER IN weaned0.051282
LOWER IN corn and soybean diet0.051282
LOWER IN age 4-7 weeks0.051282
LOWER IN state of oregon0.051282
rhesus macaque0.051282
zambia0.051282
baboon0.051282
papio0.051282
LOWER IN papio kindae0.051282
LOWER IN papio ursinus0.051282
como zoo0.051282
chlorocebus aethiops0.051282
vervet monkey0.051282
children0.051282
tunapuco0.051282
LOWER IN state of oklahoma0.051282
LOWER IN age 3-60.051282
LOWER IN age 8-120.051282
chlorocebus djamdjamensis0.051282
bale monkey0.051282
LOWER IN madagascar0.051282
bangui0.051282
LOWER IN antananarivo0.051282
LOWER IN arm0.051282
LOWER IN forearm0.051282
age >940.051282
LOWER IN age 19-240.051282
LOWER IN soldiers0.051282
united states of america0.050360
LOWER IN age 1-3 years0.050000
animal product diet0.050000
village0.050000
pan troglodytes troglodytes0.050000
LOWER IN european0.050000
asian0.050000
papio anubis0.050000
pongo abelii0.050000
sumatran orangutan0.050000
sigmoid colon0.050000
central african republic0.050000
parasitic helminthiasis infectious disease0.048780
nigeria0.048780
age 10-15 years0.048780
LOWER IN caucasian0.048780
LOWER IN china0.048780
jiangxi province0.048780
terminal ileum0.048780
peru0.048780
gay0.048780
control0.047847
guangzhou city prefecture0.047619
LOWER IN msw0.047619
LOWER IN heterosexual0.047619
Fraction of dbbact annotations with this term covered by the query
TermScore
cameroon0.666667
rural community0.600000
helminthiasis0.500000
pemba island0.500000
LOWER IN stunted growth0.500000
small village0.500000
LOWER IN age 2-4 years0.500000
indonesia0.500000
municipality of yogyakarta0.500000
taipei city0.500000
low anterior resection0.500000
kebbi state0.500000
LOWER IN plant diet0.500000
yaounde0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
LOWER IN eastern chimpanzee0.500000
central chimpanzee0.500000
LOWER IN pan troglodytes verus0.500000
LOWER IN europe0.500000
karen0.500000
myanmar0.500000
LOWER IN hmong0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
LOWER IN state of oregon0.500000
rhesus macaque0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
como zoo0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
children0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
monkey0.400000
LOWER IN age 1-3 years0.333333
animal product diet0.333333
village0.333333
pan troglodytes troglodytes0.333333
LOWER IN european0.333333
asian0.333333
papio anubis0.333333
pongo abelii0.333333
sumatran orangutan0.333333
sigmoid colon0.333333
age 30-500.333333
central african republic0.333333
age 5-13 years0.333333
LOWER IN city0.285714
LOWER IN crohn's disease0.272727
parasitic helminthiasis infectious disease0.250000
tanzania0.250000
africa0.250000
LOWER IN child0.250000
taiwan0.250000
nigeria0.250000
age 10-15 years0.250000
LOWER IN caucasian0.250000
LOWER IN china0.250000
jiangxi province0.250000
ethiopia0.250000
terminal ileum0.250000
peru0.250000
gay0.250000
bolivia0.250000
guangzhou city prefecture0.200000
LOWER IN united states of america0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
thailand0.166667
macaca mulatta0.166667
egypt0.166667
LOWER IN age < 1 year0.166667
homosexual0.166667
msm0.166667
LOWER IN mouth mucosa0.166667
LOWER IN captive0.142857
LOWER IN zoological garden0.142857
Fraction of annotations for the query sequences containing the term
TermScore
feces0.972973
homo sapiens0.810811
adult0.378378
rural community0.216216
child0.189189
united states of america0.189189
control0.135135
china0.135135
monkey0.135135
female0.081081
africa0.081081
LOWER IN child0.081081
LOWER IN crohn's disease0.081081
LOWER IN control0.054054
tanzania0.054054
pemba island0.054054
small village0.054054
LOWER IN city0.054054
taiwan0.054054
taipei city0.054054
low anterior resection0.054054
cameroon0.054054
male0.054054
thailand0.054054
zoological garden0.054054
LOWER IN united states of america0.054054
ethiopia0.054054
age 30-500.054054
age 60-790.054054
age 5-13 years0.054054
bolivia0.054054
chuquisaca department0.054054
parasitic helminthiasis infectious disease0.027027
helminthiasis0.027027
LOWER IN stunted growth0.027027
LOWER IN age 1-3 years0.027027
LOWER IN age 2-4 years0.027027
indonesia0.027027
municipality of yogyakarta0.027027
guangzhou city prefecture0.027027
nigeria0.027027
kebbi state0.027027
age 10-15 years0.027027
diet0.027027
animal product diet0.027027
LOWER IN plant diet0.027027
city0.027027
yaounde0.027027
kingdom of norway0.027027
LOWER IN colon0.027027
LOWER IN ileum0.027027
village0.027027
nouabale-ndoki national park0.027027
republic of congo0.027027
brazil0.027027
LOWER IN female0.027027
LOWER IN eastern chimpanzee0.027027
central chimpanzee0.027027
LOWER IN pan troglodytes verus0.027027
LOWER IN europe0.027027
LOWER IN captive0.027027
LOWER IN zoological garden0.027027
pan troglodytes troglodytes0.027027
wild0.027027
LOWER IN caucasian0.027027
LOWER IN european0.027027
asian0.027027
state of new york0.027027
karen0.027027
myanmar0.027027
LOWER IN hmong0.027027
LOWER IN china0.027027
pig0.027027
sus scrofa0.027027
farm0.027027
jiangxi province0.027027
suckling0.027027
preweaned0.027027
age 2-4 weeks0.027027
LOWER IN weaned0.027027
LOWER IN corn and soybean diet0.027027
LOWER IN age 4-7 weeks0.027027
LOWER IN state of oregon0.027027
state of california0.027027
rhesus macaque0.027027
macaca mulatta0.027027
research facility0.027027
captive0.027027
zambia0.027027
baboon0.027027
papio0.027027
papio anubis0.027027
LOWER IN wild0.027027
LOWER IN papio kindae0.027027
LOWER IN papio ursinus0.027027
pongo abelii0.027027
sumatran orangutan0.027027
state of minnesota0.027027
como zoo0.027027
LOWER IN duodenum0.027027
Exp. ID User ID Description Date Region Flag Sequences
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 15
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v4No1 / 18
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to age 2-4 years child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
729amnon high in central chimpanzee pan troglodytes troglodytes cameroon wild compared to eastern chimpanzee pan troglodytes verus europe captive zoological garden in feces monkey 2021-01-05v3No1 / 288
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org