Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGATTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGTTATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.321383
canis lupus familiaris0.258621
dog0.230922
homo sapiens0.205792
united states of america0.150517
adult0.134961
farm0.114414
china0.113177
infant0.109705
zoological garden0.098765
skin0.096970
city of melbourne0.085106
rural community0.083333
child0.083333
pig0.079576
sus scrofa0.079576
bird0.078947
australia0.078947
wild0.076923
kingdom of denmark0.072948
research facility0.069264
foxhound0.066038
state of minnesota0.062921
captive0.060150
state of michigan0.059259
city0.057772
canis lupus0.057143
urocyon littoralis catalinae0.057143
santa catalina island fox0.057143
urocyon littoralis0.057143
wolf0.056338
rectum0.056338
obsolete_juvenile stage0.056338
santa catalina island0.055556
sweden0.055172
kingdom of spain0.050420
california condor0.048077
gymnogyps californianus0.048077
cat0.047695
LOWER IN united states of america0.047506
state of idaho0.046948
felis catus0.046948
crohn's disease0.045872
age0.044593
c57bl/60.041580
italy0.041152
caecum0.039267
arm0.039216
meat diet0.038835
chuquisaca department0.038835
namibia0.038095
high protein diet0.038095
age 5-13 years0.038095
LOWER IN control0.038043
control0.037838
bolivia0.037383
mus musculus0.037267
tonsil0.036697
french republic0.036364
river0.036036
colon0.035398
rat0.034783
puppy0.029412
snake farm0.029412
adula0.029412
age one month0.029412
wildlife sactuary0.029412
acinonyx jubatus0.029412
africa0.029412
age >940.029412
forearm0.029412
LOWER IN city0.029268
wastewater treatment plant0.029197
india0.029126
age 2 days0.028986
snake0.028986
LOWER IN low bmi0.028986
duodenum0.028708
female0.028640
united kingdom0.028571
jiangsu province0.028571
high bmi0.028436
commonwealth of pennsylvania0.028369
ulcerative colitis0.028369
state of tennessee0.028169
rectal swab0.028169
state of north carolina0.028169
hunan province0.027397
new york city0.027397
south africa0.027397
LOWER IN feces0.027397
israel0.026846
state of new york0.026316
rattus norvegicus0.026316
fresh water0.026144
water0.025974
japan0.024691
mouse0.021390
LOWER IN age 4 weeks0.019900
madagascar0.019900
Fraction of dbbact annotations with this term covered by the query
TermScore
city of melbourne0.666667
LOWER IN age 4 weeks0.666667
madagascar0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
canis lupus familiaris0.576923
dog0.545455
age 3 days0.500000
przewalski horse0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
LOWER IN zinc deficiency0.500000
LOWER IN low zinc diet0.500000
finch0.500000
geospiza difficilis0.500000
sharp-beaked ground finch0.500000
mustela putorius furo0.500000
ferret0.500000
ailurus fulgens0.500000
red panda0.500000
california condor0.500000
gymnogyps californianus0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
puppy0.500000
snake farm0.500000
adula0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
canis mesomelas0.500000
age one month0.500000
inflammatory bowel disease0.500000
canis lupus0.500000
gastric bypass0.500000
lymphoma0.500000
como zoo0.500000
white-faced saki0.500000
pithecia pithecia0.500000
age one week0.500000
wildlife sactuary0.500000
acinonyx jubatus0.500000
mammalian milk beverage0.500000
rural community0.500000
small village0.500000
age 8 hours0.500000
dolphin parasite0.500000
croatia0.500000
opatija0.500000
anisakis pegreffii0.500000
domestic0.500000
dog breeding center0.500000
lycaon pictus0.500000
african wild dog0.500000
foxhound0.500000
meat diet0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
LOWER IN age > 1 year0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
LOWER IN inactive vent0.500000
hmong 2nd generation0.500000
hmong0.500000
gut content0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
cold environment0.500000
age 0-10.500000
LOWER IN age 1-20.500000
nicotiana galuca0.500000
LOWER IN dog breeding center0.500000
LOWER IN canis lupus familiaris0.500000
LOWER IN dog0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
urocyon littoralis0.500000
labial commissure0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
equine grass sickness0.500000
ibadan0.500000
age 1-3 weeks0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
state of louisiana0.500000
LOWER IN age 8 weeks0.500000
anser0.500000
goose0.500000
greylag goose0.500000
himalayas0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.671717
homo sapiens0.313131
united states of america0.308081
canis lupus familiaris0.166667
adult0.161616
china0.151515
dog0.146465
research facility0.090909
farm0.085859
infant0.065657
zoological garden0.060606
skin0.060606
child0.055556
wild0.055556
australia0.055556
pig0.050505
sus scrofa0.050505
bird0.045455
rural community0.045455
city of melbourne0.045455
captive0.040404
state of michigan0.040404
kingdom of denmark0.040404
control0.035354
LOWER IN control0.035354
state of minnesota0.035354
foxhound0.035354
city0.035354
kingdom of spain0.030303
mus musculus0.030303
canis lupus0.030303
wolf0.030303
sweden0.030303
urocyon littoralis catalinae0.030303
santa catalina island fox0.030303
santa catalina island0.030303
urocyon littoralis0.030303
rectum0.030303
obsolete_juvenile stage0.030303
caecum0.025253
c57bl/60.025253
state of idaho0.025253
california condor0.025253
gymnogyps californianus0.025253
crohn's disease0.025253
italy0.025253
felis catus0.025253
cat0.025253
age0.025253
LOWER IN united states of america0.025253
female0.020202
french republic0.020202
namibia0.020202
rat0.020202
tonsil0.020202
high protein diet0.020202
meat diet0.020202
water0.020202
colon0.020202
age 5-13 years0.020202
bolivia0.020202
chuquisaca department0.020202
arm0.020202
river0.020202
mouse0.015152
state of tennessee0.015152
puppy0.015152
age 2 days0.015152
rectal swab0.015152
snake0.015152
snake farm0.015152
adula0.015152
hunan province0.015152
japan0.015152
age one month0.015152
commonwealth of pennsylvania0.015152
ulcerative colitis0.015152
state of new york0.015152
new york city0.015152
rattus norvegicus0.015152
wildlife sactuary0.015152
acinonyx jubatus0.015152
LOWER IN city0.015152
state of north carolina0.015152
south africa0.015152
high bmi0.015152
LOWER IN low bmi0.015152
duodenum0.015152
india0.015152
israel0.015152
united kingdom0.015152
africa0.015152
age >940.015152
jiangsu province0.015152
forearm0.015152
wastewater treatment plant0.015152
LOWER IN feces0.015152
fresh water0.015152
soil0.015152
gallus gallus0.010101
Exp. ID User ID Description Date Region Flag Sequences
495amnoncommon gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 4
406amnondominant feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
399amnondominant feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
399amnondominant feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 9
645amnon high in feces compared to cloaca in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 9
391amnondominant feces, infant, age < 1 year, hospital, china, diarrhea2018-11-04v4No1 / 11
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
495amnondominant gallus gallus, chicken, caecum, broiler chicken, age 3 days, kingdom of spain, farm2019-03-03v4No1 / 12
645amnondominant feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 12
766amnoncommon puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 12
389amnondominant pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
15amnondominant namibia, feces, canis mesomelas2016-11-08v4No1 / 16
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
645amnondominant cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 16
753amnondominant zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 16
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
759amnondominant state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 17
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one month2018-01-14v4No1 / 18
488amnondominant canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
625amnondominant state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 18
573amnondominant feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 19
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
759amnondominant wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v4No1 / 20
766amnondominant puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 20
15amnondominant acinonyx jubatus, namibia, feces2016-11-08v4No1 / 21
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
670amnon high in adult adult organism compared to larval stage in dolphin parasite croatia opatija anisakis pegreffii 2020-09-26v4No1 / 22
759amnondominant state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v4No1 / 22
399amnondominant feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 23
702amnondominant canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v4No1 / 23
150amnondominant canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 24
340amnondominant feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 24
670amnoncommon dolphin parasite, croatia, opatija, anisakis pegreffii, adult organism, adult2020-09-26v4No1 / 24
702amnondominant felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 24
753amnondominant china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 24
406amnondominant feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 26
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high protein diet, meat diet2021-08-29v4No1 / 28
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high fiber2021-08-29v4No1 / 29
573amnoncommon feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 30
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
669amnon high in age 2 weeks compared to age 1 year in sweden infant feces homo sapiens 2020-09-26v4No1 / 33
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 35
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
663amnon high in obese body mass index status high bmi obesity compared to low bmi in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 44
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 47
645amnoncommon feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 49
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
702amnoncommon felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 51
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in homo sapiens feces infant india )2016-12-19v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v4No1 / 57
759amnoncommon state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v4No1 / 57
759amnoncommon wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v4No1 / 58
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, lip, labial commissure2020-01-22v4No1 / 68
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v4No1 / 73
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
759amnon high in wildlife sactuary canis lupus wolf compared to dog canis lupus familiaris in state of minnesota united states of america feces 2021-04-06v4No1 / 78
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
648amnoncommon united states of america, dog, canis lupus familiaris, feces, state of louisiana2020-09-06v4No1 / 83
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 92
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
759amnoncommon state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 94
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 98
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 99
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
822amnon high in meat diet high protein diet compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 103
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 116
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
753amnoncommon china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
822amnon high in meat diet high protein diet compared to high fiber in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 123
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 125
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 140
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
822amnoncommon hydrolized diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 145
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
822amnoncommon meat diet, high protein diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 151
822amnoncommon high fiber, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in autumn summer compared to spring in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 644
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656

Problems / suggestions? Please email info AT dbbact DOT org