Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGAATGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTATTTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.505080
feces0.434640
adult0.367506
child0.201536
united states of america0.154630
sus scrofa0.150628
pig0.150628
china0.150278
control0.150049
obsolete_juvenile stage0.108247
city0.107858
jiangsu province0.092308
LOWER IN crohn's disease0.086957
rural community0.080972
infant0.077821
farm0.074212
LOWER IN ulcerative colitis0.070796
chuquisaca department0.070175
india0.070175
age 5-13 years0.067797
bolivia0.065574
monkey0.065574
rumen0.065574
united kingdom0.064516
caecum0.059113
tibet autonomous region0.054299
colombia0.054054
LOWER IN finland0.053571
state of michigan0.053097
rectum0.052174
bos taurus0.048980
age0.048000
diet0.046154
state of california0.044610
female0.043165
metabolic syndrome0.036697
tonsil0.036697
jordan0.036364
nanchang city prefecture0.036364
age 8-120.036364
age 60-790.036364
age 30-500.036364
age >940.036364
toronto0.036364
oslo0.036364
age 30-400.036364
cron diet0.036364
age 13-140.036364
cecal content0.036364
small village0.036364
age 130.036364
zambia0.036364
africa0.036364
mongolian sheep0.036364
LOWER IN mouth mucosa0.036364
holstein-friesian bull0.036364
LOWER IN infant0.036036
caloric restriction diet0.035714
age < 3 years0.035714
kingdom of denmark0.035714
juvenile organism0.035088
zoological garden0.035088
ileum0.035088
ireland0.035088
ovis aries0.033898
belgium0.033333
LOWER IN mouth0.033333
kingdom of norway0.032787
colon0.032000
kingdom of spain0.031746
wild0.030769
LOWER IN type i diabetes mellitus0.018519
new york county0.018519
LOWER IN chronic fatigue syndrome0.018519
LOWER IN hmong 2nd generation0.018519
LOWER IN hmong0.018519
salmonella gastroenteritis0.018519
LOWER IN insomnia0.018519
metabolic syndrome x0.018519
azerbaijan0.018519
age 19-240.018519
commonwealth of pennsylvania0.018519
LOWER IN inflammatory bowel disease0.018519
LOWER IN sucram0.018519
standard feed0.018519
age 3-60.018519
lima0.018519
shantytown0.018519
mild0.018519
LOWER IN severe0.018519
age 6-10 weeks0.018519
irritable bowel syndrome0.018519
LOWER IN tibetan pig0.018519
LOWER IN tibetan swine0.018519
glasgow0.018519
el salvador0.018519
estonia0.018519
LOWER IN age 1-3 weeks0.018519
LOWER IN age 3-60.018519
spondyloarthritis0.018519
Fraction of dbbact annotations with this term covered by the query
TermScore
tibet autonomous region0.666667
metabolic syndrome0.666667
sus scrofa0.666667
pig0.666667
tonsil0.666667
colombia0.600000
LOWER IN ulcerative colitis0.571429
LOWER IN crohn's disease0.555556
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN hmong 2nd generation0.500000
LOWER IN hmong0.500000
salmonella gastroenteritis0.500000
LOWER IN insomnia0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN sucram0.500000
standard feed0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
age 6-10 weeks0.500000
chuquisaca department0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
toronto0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
estonia0.500000
LOWER IN finland0.500000
LOWER IN age 1-3 weeks0.500000
LOWER IN age 3-60.500000
age 130.500000
india0.500000
spondyloarthritis0.500000
spondylitis0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
canada0.500000
atherosclerosis0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
mongolian sheep0.500000
male0.500000
bangladesh0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
hadza0.500000
cecum0.500000
LOWER IN short bowel syndrome0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.849057
homo sapiens0.820755
adult0.367925
united states of america0.245283
china0.216981
control0.179245
child0.141509
sus scrofa0.084906
pig0.084906
obsolete_juvenile stage0.066038
city0.066038
jiangsu province0.056604
LOWER IN crohn's disease0.047170
farm0.047170
rural community0.047170
infant0.047170
LOWER IN ulcerative colitis0.037736
united kingdom0.037736
age 5-13 years0.037736
bolivia0.037736
chuquisaca department0.037736
caecum0.037736
india0.037736
monkey0.037736
rumen0.037736
tibet autonomous region0.028302
state of california0.028302
colombia0.028302
female0.028302
diet0.028302
state of michigan0.028302
LOWER IN finland0.028302
rectum0.028302
age0.028302
bos taurus0.028302
jordan0.018868
metabolic syndrome0.018868
nanchang city prefecture0.018868
age 8-120.018868
belgium0.018868
age 60-790.018868
tonsil0.018868
age 30-500.018868
kingdom of spain0.018868
age >940.018868
toronto0.018868
kingdom of norway0.018868
oslo0.018868
age 30-400.018868
cron diet0.018868
caloric restriction diet0.018868
age 13-140.018868
cecal content0.018868
LOWER IN infant0.018868
small village0.018868
age < 3 years0.018868
age 130.018868
juvenile organism0.018868
zambia0.018868
wild0.018868
africa0.018868
mongolian sheep0.018868
ovis aries0.018868
zoological garden0.018868
kingdom of denmark0.018868
ileum0.018868
colon0.018868
LOWER IN mouth mucosa0.018868
LOWER IN mouth0.018868
holstein-friesian bull0.018868
ireland0.018868
LOWER IN type i diabetes mellitus0.009434
LOWER IN diabetes mellitus0.009434
new york county0.009434
LOWER IN chronic fatigue syndrome0.009434
LOWER IN hmong 2nd generation0.009434
LOWER IN hmong0.009434
australia0.009434
hospital0.009434
salmonella gastroenteritis0.009434
diarrhea0.009434
tibetan plateau0.009434
LOWER IN insomnia0.009434
italy0.009434
high bmi0.009434
obesity0.009434
metabolic syndrome x0.009434
germany0.009434
azerbaijan0.009434
age 19-240.009434
commonwealth of pennsylvania0.009434
LOWER IN child0.009434
LOWER IN inflammatory bowel disease0.009434
LOWER IN sucram0.009434
gastrointestinal system0.009434
standard feed0.009434
age 3-60.009434
lima0.009434
shantytown0.009434
state of oklahoma0.009434
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong 2nd generation hmong in homo sapiens feces )2018-11-18v4No1 / 52
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org