Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGAATGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTATTTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.518792
feces0.440152
adult0.366726
child0.213632
united states of america0.158491
sus scrofa0.153191
pig0.153191
control0.146580
china0.140000
obsolete_juvenile stage0.109948
city0.109546
jiangsu province0.093750
LOWER IN crohn's disease0.088496
rural community0.082305
infant0.079051
farm0.076046
LOWER IN ulcerative colitis0.072072
chuquisaca department0.071429
age 5-13 years0.071429
india0.071429
rumen0.068182
bolivia0.066667
monkey0.066667
united kingdom0.065574
caecum0.060606
tibet autonomous region0.055300
colombia0.055046
LOWER IN finland0.054545
state of michigan0.054054
rectum0.053097
bos taurus0.050420
age0.048780
diet0.047244
state of california0.045283
female0.044118
metabolic syndrome0.037383
tonsil0.037383
jordan0.037037
nanchang city prefecture0.037037
age 8-120.037037
age 60-790.037037
age 30-500.037037
age >940.037037
toronto0.037037
oslo0.037037
age 30-400.037037
cron diet0.037037
age 13-140.037037
cecal content0.037037
small village0.037037
age 130.037037
zambia0.037037
africa0.037037
mongolian sheep0.037037
LOWER IN mouth mucosa0.037037
holstein-friesian bull0.037037
LOWER IN infant0.036697
zoological garden0.036697
caloric restriction diet0.036364
age < 3 years0.036364
kingdom of denmark0.036364
juvenile organism0.035714
ileum0.035714
ireland0.035714
belgium0.034483
ovis aries0.034483
LOWER IN mouth0.033898
kingdom of norway0.033333
colon0.032787
kingdom of spain0.032258
wild0.031250
LOWER IN type i diabetes mellitus0.018868
new york county0.018868
LOWER IN chronic fatigue syndrome0.018868
LOWER IN hmong 2nd generation0.018868
LOWER IN hmong0.018868
salmonella gastroenteritis0.018868
metabolic syndrome x0.018868
azerbaijan0.018868
age 19-240.018868
commonwealth of pennsylvania0.018868
LOWER IN inflammatory bowel disease0.018868
LOWER IN sucram0.018868
standard feed0.018868
age 3-60.018868
lima0.018868
shantytown0.018868
mild0.018868
LOWER IN severe0.018868
age 6-10 weeks0.018868
irritable bowel syndrome0.018868
LOWER IN tibetan pig0.018868
LOWER IN tibetan swine0.018868
glasgow0.018868
el salvador0.018868
estonia0.018868
LOWER IN age 1-3 weeks0.018868
LOWER IN age 3-60.018868
spondylitis0.018868
spondyloarthritis0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
tibet autonomous region0.666667
metabolic syndrome0.666667
sus scrofa0.666667
pig0.666667
tonsil0.666667
colombia0.600000
LOWER IN ulcerative colitis0.571429
LOWER IN crohn's disease0.555556
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN hmong 2nd generation0.500000
LOWER IN hmong0.500000
salmonella gastroenteritis0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 19-240.500000
age 8-120.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN sucram0.500000
standard feed0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
age 6-10 weeks0.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
toronto0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
estonia0.500000
LOWER IN finland0.500000
LOWER IN age 1-3 weeks0.500000
LOWER IN age 3-60.500000
age 130.500000
india0.500000
spondylitis0.500000
spondyloarthritis0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
stomach neoplasm0.500000
gastric carcinoma0.500000
atherosclerosis0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
mongolian sheep0.500000
bangladesh0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
papio anubis0.500000
olive baboon0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
hadza0.500000
cecum0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN age 4-7 weeks0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN weaned0.500000
age 2-4 weeks0.500000
preweaned0.500000
suckling0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.846154
homo sapiens0.817308
adult0.355769
united states of america0.250000
china0.201923
control0.173077
child0.144231
sus scrofa0.086538
pig0.086538
obsolete_juvenile stage0.067308
city0.067308
jiangsu province0.057692
LOWER IN crohn's disease0.048077
farm0.048077
rural community0.048077
infant0.048077
LOWER IN ulcerative colitis0.038462
united kingdom0.038462
chuquisaca department0.038462
bolivia0.038462
age 5-13 years0.038462
caecum0.038462
india0.038462
monkey0.038462
rumen0.038462
tibet autonomous region0.028846
state of california0.028846
colombia0.028846
female0.028846
diet0.028846
state of michigan0.028846
LOWER IN finland0.028846
rectum0.028846
age0.028846
bos taurus0.028846
jordan0.019231
metabolic syndrome0.019231
nanchang city prefecture0.019231
age 8-120.019231
belgium0.019231
age 60-790.019231
tonsil0.019231
age 30-500.019231
kingdom of spain0.019231
age >940.019231
toronto0.019231
kingdom of norway0.019231
oslo0.019231
age 30-400.019231
cron diet0.019231
caloric restriction diet0.019231
age 13-140.019231
cecal content0.019231
LOWER IN infant0.019231
small village0.019231
age < 3 years0.019231
age 130.019231
juvenile organism0.019231
zambia0.019231
wild0.019231
africa0.019231
mongolian sheep0.019231
ovis aries0.019231
zoological garden0.019231
kingdom of denmark0.019231
ileum0.019231
colon0.019231
LOWER IN mouth mucosa0.019231
LOWER IN mouth0.019231
holstein-friesian bull0.019231
ireland0.019231
LOWER IN type i diabetes mellitus0.009615
LOWER IN diabetes mellitus0.009615
new york county0.009615
LOWER IN chronic fatigue syndrome0.009615
LOWER IN hmong 2nd generation0.009615
LOWER IN hmong0.009615
diarrhea0.009615
australia0.009615
hospital0.009615
salmonella gastroenteritis0.009615
tibetan plateau0.009615
italy0.009615
obesity0.009615
high bmi0.009615
metabolic syndrome x0.009615
germany0.009615
azerbaijan0.009615
age 19-240.009615
commonwealth of pennsylvania0.009615
LOWER IN child0.009615
LOWER IN inflammatory bowel disease0.009615
LOWER IN sucram0.009615
gastrointestinal system0.009615
standard feed0.009615
age 3-60.009615
lima0.009615
shantytown0.009615
state of oklahoma0.009615
mild0.009615
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong 2nd generation hmong in homo sapiens feces )2018-11-18v4No1 / 52
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa united kingdom pig )2017-11-26v4No1 / 109
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-10v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, china, ovis aries2017-04-09v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in age 2-4 weeks preweaned suckling compared to age 4-7 weeks corn and soybean diet weaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 347
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org