Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGCTGATTAAGTCAGCGGTGAAAGGTAGCAGCTTAACTGTTTTACATGCCGTTGATACTGGTTAGCTTGAGTTGACAGAAGGCAGATAGAATTCCTG
common ontology terms
term enrichment score
TermScore
river0.482759
fresh water0.349206
carnivorous beetle0.250000
poland0.250000
beetle0.250000
water0.225248
whole body0.222222
state of wisconsin0.222222
raba river0.210526
skin0.185185
sand0.160000
kingdom of spain0.160000
zebrafish0.117647
larvae0.117647
age 15d0.117647
rana pipiens0.117647
northern leopard frog0.117647
estuary0.117647
estuary water0.117647
salinity <5 ppt0.117647
bilbao0.117647
jiulong river0.117647
fujian province0.117647
fish farm0.117647
biofilter0.117647
depth 1m0.117647
digesta0.111111
jiangxi province0.111111
depth 0.5m0.111111
surface0.111111
particle0.111111
filtered 2.7um0.111111
mississippi river0.105263
japan0.097561
danio rerio0.095238
tadpole0.095238
hunan province0.095238
biofilm0.095238
fish0.076923
united states of america0.069276
LOWER IN streptomycin0.062500
intestine0.062500
bembidion modestum0.062500
bembidion decorum0.062500
herbivorous beetle0.062500
LOWER IN detritivorous beetle0.062500
LOWER IN bulgaria0.062500
lithobates catesbeianus0.062500
bembidion punctulatum0.062500
bembidion varicolor0.062500
zoo0.062500
andrias japonicus0.062500
japanese giant salamander0.062500
LOWER IN area designated as a nature reserve0.062500
pseudacris crucifer0.062500
peeper0.062500
LOWER IN middle0.062500
LOWER IN bottom0.062500
LOWER IN digestive system0.062500
LOWER IN frog0.062500
LOWER IN quasipaa spinosa0.062500
LOWER IN giant spiny frog0.062500
LOWER IN salinity >20 ppt0.062500
epilithic0.062500
carabidae0.062500
LOWER IN staphylinidae0.062500
lower mississippi river0.062500
LOWER IN upper mississippi river0.062500
southern united states0.062500
aquatic snake0.062500
LOWER IN terrestrial snake0.062500
LOWER IN filtered 0.2um0.062500
salamandra salamandra0.060606
salamander0.060606
rana catesbeiana0.060606
bullfrog0.060606
LOWER IN saline water0.060606
snake0.060606
china0.060000
LOWER IN pond0.058824
LOWER IN autumn0.058824
wastewater treatment plant0.058824
effluent0.058824
downstream0.058824
LOWER IN upstream0.058824
LOWER IN free floating0.058824
zoological garden0.057143
commonwealth of virginia0.057143
rock0.057143
spring0.055556
mucus0.055556
wet season0.055556
LOWER IN dry season0.055556
frog0.054054
pond0.054054
autumn0.052632
LOWER IN antibiotic0.051282
germany0.048780
LOWER IN winter0.046512
LOWER IN colon0.045455
Fraction of dbbact annotations with this term covered by the query
TermScore
state of wisconsin0.666667
zebrafish0.500000
larvae0.500000
age 15d0.500000
LOWER IN streptomycin0.500000
rana pipiens0.500000
northern leopard frog0.500000
carnivorous beetle0.500000
river0.500000
raba river0.500000
bembidion modestum0.500000
bembidion decorum0.500000
herbivorous beetle0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
lithobates catesbeianus0.500000
bembidion punctulatum0.500000
bembidion varicolor0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
bilbao0.500000
zoo0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN area designated as a nature reserve0.500000
jiulong river0.500000
fujian province0.500000
pseudacris crucifer0.500000
peeper0.500000
fish farm0.500000
biofilter0.500000
LOWER IN middle0.500000
LOWER IN bottom0.500000
LOWER IN digestive system0.500000
LOWER IN frog0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
LOWER IN salinity >20 ppt0.500000
epilithic0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
LOWER IN filtered 0.2um0.500000
sand0.400000
digesta0.333333
salamandra salamandra0.333333
salamander0.333333
poland0.333333
beetle0.333333
rana catesbeiana0.333333
bullfrog0.333333
jiangxi province0.333333
fresh water0.333333
depth 0.5m0.333333
surface0.333333
LOWER IN saline water0.333333
particle0.333333
filtered 2.7um0.333333
snake0.333333
whole body0.250000
LOWER IN pond0.250000
LOWER IN autumn0.250000
wastewater treatment plant0.250000
effluent0.250000
mississippi river0.250000
downstream0.250000
LOWER IN upstream0.250000
LOWER IN free floating0.250000
skin0.208333
kingdom of spain0.200000
zoological garden0.200000
commonwealth of virginia0.200000
rock0.200000
japan0.181818
danio rerio0.166667
tadpole0.166667
hunan province0.166667
spring0.166667
mucus0.166667
wet season0.166667
LOWER IN dry season0.166667
biofilm0.166667
water0.152174
frog0.142857
pond0.142857
autumn0.125000
LOWER IN antibiotic0.111111
fish0.090909
germany0.090909
LOWER IN winter0.076923
LOWER IN colon0.071429
summer0.062500
intestine0.058824
LOWER IN adult0.058824
Fraction of annotations for the query sequences containing the term
TermScore
river0.466667
water0.433333
united states of america0.366667
fresh water0.366667
poland0.200000
whole body0.200000
beetle0.200000
china0.200000
skin0.166667
carnivorous beetle0.166667
research facility0.133333
state of wisconsin0.133333
raba river0.133333
kingdom of spain0.133333
sand0.100000
fish0.066667
zebrafish0.066667
danio rerio0.066667
larvae0.066667
age 15d0.066667
rana pipiens0.066667
northern leopard frog0.066667
digesta0.066667
intestine0.066667
tadpole0.066667
japan0.066667
hunan province0.066667
jiangxi province0.066667
estuary0.066667
estuary water0.066667
salinity <5 ppt0.066667
bilbao0.066667
depth 0.5m0.066667
jiulong river0.066667
fujian province0.066667
fish farm0.066667
biofilter0.066667
surface0.066667
biofilm0.066667
mississippi river0.066667
depth 1m0.066667
particle0.066667
filtered 2.7um0.066667
control0.033333
LOWER IN antibiotic0.033333
LOWER IN streptomycin0.033333
LOWER IN adult0.033333
salamandra salamandra0.033333
salamander0.033333
germany0.033333
bembidion modestum0.033333
bembidion decorum0.033333
herbivorous beetle0.033333
LOWER IN detritivorous beetle0.033333
LOWER IN bulgaria0.033333
adult0.033333
rana catesbeiana0.033333
bullfrog0.033333
lithobates catesbeianus0.033333
frog0.033333
pond0.033333
spring0.033333
bembidion punctulatum0.033333
bembidion varicolor0.033333
zoological garden0.033333
zoo0.033333
LOWER IN pond0.033333
andrias japonicus0.033333
japanese giant salamander0.033333
LOWER IN area designated as a nature reserve0.033333
autumn0.033333
commonwealth of virginia0.033333
mucus0.033333
pseudacris crucifer0.033333
peeper0.033333
LOWER IN middle0.033333
LOWER IN bottom0.033333
LOWER IN digestive system0.033333
LOWER IN colon0.033333
LOWER IN frog0.033333
LOWER IN quasipaa spinosa0.033333
LOWER IN giant spiny frog0.033333
summer0.033333
wet season0.033333
LOWER IN winter0.033333
LOWER IN dry season0.033333
LOWER IN autumn0.033333
LOWER IN saline water0.033333
LOWER IN salinity >20 ppt0.033333
wastewater treatment plant0.033333
effluent0.033333
rock0.033333
epilithic0.033333
carabidae0.033333
LOWER IN staphylinidae0.033333
lower mississippi river0.033333
downstream0.033333
LOWER IN upper mississippi river0.033333
LOWER IN upstream0.033333
snake0.033333
Exp. ID User ID Description Date Region Flag Sequences
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in fish zebrafish danio rerio research facility larvae age 15d united states of america )2019-01-08v4No1 / 25
446amnoncommon fish, zebrafish, danio rerio, research facility, larvae, age 15d, united states of america2019-01-08v4No1 / 31
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in water fresh water fish farm biofilter sand united states of america state of wisconsin )2019-01-12v4No1 / 448
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266

Problems / suggestions? Please email info AT dbbact DOT org