Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGCTGATTAAGTCAGCGGTGAAAGGTAGCAGCTTAACTGTTTTACATGCCGTTGATACTGGTTAGCTTGAGTTGACAGAAGGCAGATAGAATTCCTG
common ontology terms
term enrichment score
TermScore
river0.437500
fresh water0.402878
water0.268446
poland0.250000
beetle0.222222
carnivorous beetle0.217391
spring water0.217391
state of wisconsin0.190476
raba river0.181818
whole body0.166667
skin0.158730
sand0.137931
kingdom of spain0.133333
zebrafish0.100000
larvae0.100000
age 15d0.100000
rana pipiens0.100000
northern leopard frog0.100000
estuary0.100000
estuary water0.100000
salinity <5 ppt0.100000
bilbao0.100000
jiulong river0.100000
fujian province0.100000
biofilter0.100000
depth 1m0.100000
digesta0.095238
jiangxi province0.095238
depth 0.5m0.095238
fish farm0.095238
surface0.095238
particle0.095238
filtered 2.7um0.095238
mississippi river0.090909
state of florida0.090090
japan0.085106
danio rerio0.083333
tadpole0.083333
hunan province0.083333
biofilm0.083333
united states of america0.073733
fish0.064516
china0.063709
intestine0.052632
LOWER IN streptomycin0.052632
turtle farm0.052632
bembidion modestum0.052632
bembidion decorum0.052632
herbivorous beetle0.052632
LOWER IN detritivorous beetle0.052632
LOWER IN bulgaria0.052632
lithobates catesbeianus0.052632
pond0.052632
spring0.052632
bembidion punctulatum0.052632
bembidion varicolor0.052632
zoo0.052632
andrias japonicus0.052632
japanese giant salamander0.052632
LOWER IN area designated as a nature reserve0.052632
location 50.052632
location 30.052632
pseudacris crucifer0.052632
peeper0.052632
LOWER IN middle0.052632
LOWER IN bottom0.052632
LOWER IN digestive system0.052632
LOWER IN frog0.052632
LOWER IN quasipaa spinosa0.052632
LOWER IN giant spiny frog0.052632
location 10.052632
LOWER IN salinity >20 ppt0.052632
location 20.052632
location 40.052632
epilithic0.052632
carabidae0.052632
LOWER IN staphylinidae0.052632
lower mississippi river0.052632
LOWER IN upper mississippi river0.052632
southern united states0.052632
aquatic snake0.052632
LOWER IN terrestrial snake0.052632
LOWER IN filtered 0.2um0.052632
salamandra salamandra0.051282
salamander0.051282
hainan autonomous prefecture0.051282
rana catesbeiana0.051282
bullfrog0.051282
LOWER IN saline water0.051282
snake0.051282
LOWER IN pond0.050000
wastewater treatment plant0.050000
effluent0.050000
downstream0.050000
LOWER IN upstream0.050000
LOWER IN free floating0.050000
pond water0.048780
commonwealth of virginia0.048780
LOWER IN autumn0.048780
rock0.048780
Fraction of dbbact annotations with this term covered by the query
TermScore
state of wisconsin0.666667
zebrafish0.500000
larvae0.500000
age 15d0.500000
LOWER IN streptomycin0.500000
rana pipiens0.500000
northern leopard frog0.500000
turtle farm0.500000
carnivorous beetle0.500000
river0.500000
poland0.500000
raba river0.500000
bembidion modestum0.500000
bembidion decorum0.500000
herbivorous beetle0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
lithobates catesbeianus0.500000
pond0.500000
spring0.500000
bembidion punctulatum0.500000
bembidion varicolor0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
bilbao0.500000
zoo0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN area designated as a nature reserve0.500000
jiulong river0.500000
fujian province0.500000
spring water0.500000
location 50.500000
location 30.500000
pseudacris crucifer0.500000
peeper0.500000
biofilter0.500000
LOWER IN middle0.500000
LOWER IN bottom0.500000
LOWER IN digestive system0.500000
LOWER IN frog0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
location 10.500000
LOWER IN salinity >20 ppt0.500000
location 20.500000
location 40.500000
epilithic0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
southern united states0.500000
aquatic snake0.500000
LOWER IN terrestrial snake0.500000
LOWER IN filtered 0.2um0.500000
sand0.400000
fresh water0.368421
digesta0.333333
salamandra salamandra0.333333
salamander0.333333
hainan autonomous prefecture0.333333
beetle0.333333
rana catesbeiana0.333333
bullfrog0.333333
jiangxi province0.333333
depth 0.5m0.333333
fish farm0.333333
surface0.333333
LOWER IN saline water0.333333
particle0.333333
filtered 2.7um0.333333
snake0.333333
LOWER IN pond0.250000
wastewater treatment plant0.250000
effluent0.250000
mississippi river0.250000
downstream0.250000
LOWER IN upstream0.250000
LOWER IN free floating0.250000
pond water0.200000
commonwealth of virginia0.200000
LOWER IN autumn0.200000
rock0.200000
skin0.185185
japan0.181818
water0.180000
danio rerio0.166667
tadpole0.166667
whole body0.166667
hunan province0.166667
kingdom of spain0.166667
mucus0.166667
wet season0.166667
LOWER IN dry season0.166667
biofilm0.166667
frog0.142857
LOWER IN antibiotic0.111111
Fraction of annotations for the query sequences containing the term
TermScore
water0.527778
united states of america0.444444
fresh water0.444444
river0.388889
china0.194444
poland0.166667
whole body0.166667
beetle0.166667
skin0.138889
carnivorous beetle0.138889
state of florida0.138889
spring water0.138889
research facility0.111111
state of wisconsin0.111111
raba river0.111111
kingdom of spain0.111111
sand0.083333
fish0.055556
zebrafish0.055556
danio rerio0.055556
larvae0.055556
age 15d0.055556
rana pipiens0.055556
northern leopard frog0.055556
digesta0.055556
intestine0.055556
tadpole0.055556
japan0.055556
hunan province0.055556
jiangxi province0.055556
estuary0.055556
estuary water0.055556
salinity <5 ppt0.055556
bilbao0.055556
depth 0.5m0.055556
jiulong river0.055556
fujian province0.055556
fish farm0.055556
biofilter0.055556
surface0.055556
biofilm0.055556
mississippi river0.055556
depth 1m0.055556
particle0.055556
filtered 2.7um0.055556
control0.027778
LOWER IN antibiotic0.027778
LOWER IN streptomycin0.027778
LOWER IN adult0.027778
salamandra salamandra0.027778
salamander0.027778
germany0.027778
turtle farm0.027778
farm0.027778
hainan autonomous prefecture0.027778
pond water0.027778
bembidion modestum0.027778
bembidion decorum0.027778
herbivorous beetle0.027778
LOWER IN detritivorous beetle0.027778
LOWER IN bulgaria0.027778
adult0.027778
rana catesbeiana0.027778
bullfrog0.027778
lithobates catesbeianus0.027778
frog0.027778
pond0.027778
spring0.027778
bembidion punctulatum0.027778
bembidion varicolor0.027778
zoological garden0.027778
zoo0.027778
LOWER IN pond0.027778
andrias japonicus0.027778
japanese giant salamander0.027778
LOWER IN area designated as a nature reserve0.027778
autumn0.027778
location 50.027778
location 30.027778
commonwealth of virginia0.027778
mucus0.027778
pseudacris crucifer0.027778
peeper0.027778
LOWER IN middle0.027778
LOWER IN bottom0.027778
LOWER IN digestive system0.027778
LOWER IN colon0.027778
LOWER IN frog0.027778
LOWER IN quasipaa spinosa0.027778
LOWER IN giant spiny frog0.027778
location 10.027778
summer0.027778
wet season0.027778
LOWER IN winter0.027778
LOWER IN dry season0.027778
LOWER IN autumn0.027778
LOWER IN saline water0.027778
LOWER IN salinity >20 ppt0.027778
location 20.027778
wastewater treatment plant0.027778
Exp. ID User ID Description Date Region Flag Sequences
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in fish zebrafish danio rerio research facility larvae age 15d united states of america )2019-01-08v4No1 / 25
446amnoncommon fish, zebrafish, danio rerio, research facility, larvae, age 15d, united states of america2019-01-08v4No1 / 31
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion varicolor2019-04-18v4No1 / 308
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 420
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in water fresh water fish farm biofilter sand united states of america state of wisconsin )2019-01-12v4No1 / 448
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266

Problems / suggestions? Please email info AT dbbact DOT org