Search result for sequence:
TACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.398351
feces0.385772
adult0.255924
rural community0.205479
child0.200477
united states of america0.130612
canis lupus familiaris0.120344
obsolete_juvenile stage0.113514
LOWER IN united states of america0.109489
zoological garden0.109091
caecum0.102564
sus scrofa0.094488
pig0.094488
thailand0.090909
control0.090082
city0.089552
china0.086614
italy0.081633
hunter gatherer0.075949
homosexual0.075472
gay0.075472
msm0.075472
hmong0.074074
africa0.074074
chuquisaca department0.074074
age 5-13 years0.074074
small village0.074074
dog0.070588
state of colorado0.070175
united kingdom0.068966
bolivia0.068966
rectum0.067797
state of tennessee0.066667
colon0.058824
amerindian0.057416
venezuela0.057416
colombia0.057143
age 30 days0.056604
dairy0.056604
himalayas0.056604
india0.056604
LOWER IN duodenum0.056075
wistar rat0.055046
nepal0.055046
LOWER IN crohn's disease0.055046
left colon0.053571
czech republic0.052174
right colon0.052174
rattus0.050847
ovis aries0.050847
infant0.050847
age0.050420
rat0.044118
nigeria0.038835
acinonyx jubatus0.038835
metabolic syndrome0.038835
LOWER IN heterosexual0.038835
LOWER IN msw0.038835
spondylitis0.038462
spondyloarthritis0.038462
madagascar0.038462
antananarivo0.038462
denver0.038462
age >940.038462
el salvador0.038462
LOWER IN age 30-500.038462
LOWER IN age 60-790.038462
tunapuco0.038462
LOWER IN mouth mucosa0.038462
research facility0.038217
LOWER IN low bmi0.037736
hiv infection0.037736
tibet autonomous region0.037736
egypt0.037736
LOWER IN child0.037736
peru0.037736
kingdom of denmark0.037736
LOWER IN city0.037736
high bmi0.037037
duodenum0.037037
monkey0.037037
LOWER IN control0.036866
LOWER IN female0.036364
tibetan plateau0.036364
kingdom of spain0.036364
french republic0.035714
LOWER IN mouth0.035088
male0.033613
skin0.032258
female0.030612
daycare0.019608
age 1-5 years0.019608
trichuriasis0.019608
central african republic0.019608
bangui0.019608
hmong 2nd generation0.019608
cheetah0.019608
przewalski horse0.019608
LOWER IN lymphoma0.019608
iowa0.019608
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
rural community0.714286
nigeria0.666667
acinonyx jubatus0.666667
homosexual0.666667
gay0.666667
msm0.666667
metabolic syndrome0.666667
amerindian0.666667
venezuela0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
LOWER IN united states of america0.625000
colombia0.600000
zoological garden0.600000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
thailand0.500000
hmong0.500000
africa0.500000
central african republic0.500000
bangui0.500000
age 30 days0.500000
dairy0.500000
spondylitis0.500000
spondyloarthritis0.500000
hmong 2nd generation0.500000
cheetah0.500000
przewalski horse0.500000
LOWER IN lymphoma0.500000
iowa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
panthera leo0.500000
lion0.500000
denver0.500000
metabolic syndrome x0.500000
chepang0.500000
intestinal contents0.500000
chuquisaca department0.500000
age 5-13 years0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
beagle dog0.500000
myanmar0.500000
karen0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
small village0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
india0.500000
new delhi0.500000
atherosclerosis0.500000
toronto0.500000
theropithecus gelada0.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
heavy metal0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio anubis0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
age 30-500.500000
age 60-790.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.830000
homo sapiens0.690000
adult0.270000
united states of america0.250000
child0.140000
rural community0.120000
china0.110000
control0.110000
caecum0.080000
obsolete_juvenile stage0.070000
canis lupus familiaris0.070000
city0.060000
sus scrofa0.060000
pig0.060000
LOWER IN united states of america0.060000
zoological garden0.060000
thailand0.050000
research facility0.050000
italy0.050000
united kingdom0.050000
LOWER IN control0.040000
hmong0.040000
africa0.040000
colon0.040000
rectum0.040000
dog0.040000
state of tennessee0.040000
state of colorado0.040000
homosexual0.040000
gay0.040000
msm0.040000
chuquisaca department0.040000
bolivia0.040000
age 5-13 years0.040000
hunter gatherer0.040000
small village0.040000
colombia0.030000
female0.030000
rattus0.030000
rat0.030000
wistar rat0.030000
czech republic0.030000
ovis aries0.030000
age 30 days0.030000
dairy0.030000
right colon0.030000
left colon0.030000
nepal0.030000
himalayas0.030000
amerindian0.030000
venezuela0.030000
india0.030000
LOWER IN duodenum0.030000
LOWER IN crohn's disease0.030000
infant0.030000
age0.030000
male0.020000
LOWER IN female0.020000
nigeria0.020000
french republic0.020000
spondylitis0.020000
spondyloarthritis0.020000
high bmi0.020000
LOWER IN low bmi0.020000
hiv infection0.020000
acinonyx jubatus0.020000
tibet autonomous region0.020000
tibetan plateau0.020000
madagascar0.020000
antananarivo0.020000
denver0.020000
metabolic syndrome0.020000
kingdom of spain0.020000
LOWER IN heterosexual0.020000
LOWER IN msw0.020000
age >940.020000
duodenum0.020000
egypt0.020000
el salvador0.020000
LOWER IN child0.020000
monkey0.020000
LOWER IN age 30-500.020000
LOWER IN age 60-790.020000
peru0.020000
tunapuco0.020000
skin0.020000
kingdom of denmark0.020000
LOWER IN city0.020000
LOWER IN mouth mucosa0.020000
LOWER IN mouth0.020000
medellin metropolitan area0.010000
daycare0.010000
age 1-5 years0.010000
trichuriasis0.010000
central african republic0.010000
bangui0.010000
hmong 2nd generation0.010000
south africa0.010000
cheetah0.010000
equus przewalskii0.010000
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
358amnonhighfreq rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
256amnonhighfreq sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 19
312amnonhighfreq feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 23
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in china soil heavy metal )2017-07-29v4No1 / 337
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to colitis dnbs induced colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org