Search result for sequence:
TACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.396960
feces0.387884
adult0.254059
rural community0.198675
child0.185841
united states of america0.136468
homosexual0.123529
msm0.123529
canis lupus familiaris0.115226
obsolete_juvenile stage0.109948
LOWER IN united states of america0.105634
zoological garden0.100000
caecum0.098361
control0.094937
china0.094808
male0.093168
sus scrofa0.091603
pig0.091603
thailand0.087719
city0.086957
italy0.077519
hunter gatherer0.073171
gay0.072727
hmong0.071429
africa0.071429
chuquisaca department0.071429
small village0.071429
hiv infection0.070588
age 5-13 years0.068966
state of colorado0.067797
dog0.067416
united kingdom0.067114
bolivia0.066667
rectum0.065574
state of tennessee0.064516
colon0.056338
amerindian0.055300
venezuela0.055300
colombia0.055046
age 30 days0.054545
dairy0.054545
himalayas0.054545
rectal swab0.054545
india0.054545
LOWER IN duodenum0.053571
wistar rat0.053097
nepal0.053097
LOWER IN crohn's disease0.053097
left colon0.051724
right colon0.050420
rattus0.049180
czech republic0.049180
ovis aries0.049180
infant0.049180
age0.048780
LOWER IN control0.044053
rat0.042857
research facility0.037641
nigeria0.037383
metabolic syndrome0.037383
LOWER IN heterosexual0.037383
LOWER IN msw0.037383
spondyloarthritis0.037037
spondylitis0.037037
acinonyx jubatus0.037037
madagascar0.037037
antananarivo0.037037
denver0.037037
age >940.037037
el salvador0.037037
LOWER IN age 30-500.037037
LOWER IN age 60-790.037037
tunapuco0.037037
LOWER IN mouth mucosa0.037037
LOWER IN low bmi0.036364
tibet autonomous region0.036364
LOWER IN child0.036364
peru0.036364
kingdom of denmark0.036364
LOWER IN city0.036364
high bmi0.035714
monkey0.035714
duodenum0.035398
LOWER IN female0.035088
kingdom of spain0.035088
egypt0.035088
tibetan plateau0.034483
french republic0.033898
LOWER IN mouth0.033898
skin0.031008
female0.029557
daycare0.018868
age 1-5 years0.018868
trichuriasis0.018868
central african republic0.018868
bangui0.018868
hmong 2nd generation0.018868
przewalski horse0.018868
LOWER IN lymphoma0.018868
iowa0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.500000
homosexual0.750000
msm0.750000
hunter gatherer0.750000
rural community0.714286
nigeria0.666667
gay0.666667
metabolic syndrome0.666667
amerindian0.666667
venezuela0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
LOWER IN united states of america0.625000
colombia0.600000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
thailand0.500000
hmong0.500000
africa0.500000
central african republic0.500000
bangui0.500000
age 30 days0.500000
dairy0.500000
spondyloarthritis0.500000
spondylitis0.500000
hmong 2nd generation0.500000
acinonyx jubatus0.500000
przewalski horse0.500000
LOWER IN lymphoma0.500000
iowa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
denver0.500000
metabolic syndrome x0.500000
chepang0.500000
rectal swab0.500000
intestinal contents0.500000
chuquisaca department0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
beagle dog0.500000
myanmar0.500000
karen0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
small village0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
new delhi0.500000
india0.500000
canada0.500000
atherosclerosis0.500000
toronto0.500000
theropithecus gelada0.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
heavy metal0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
age one year0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.836538
homo sapiens0.701923
adult0.269231
united states of america0.269231
child0.134615
china0.115385
control0.115385
rural community0.115385
caecum0.076923
obsolete_juvenile stage0.067308
canis lupus familiaris0.067308
homosexual0.067308
msm0.067308
city0.057692
sus scrofa0.057692
pig0.057692
LOWER IN united states of america0.057692
zoological garden0.057692
LOWER IN control0.048077
thailand0.048077
male0.048077
research facility0.048077
italy0.048077
united kingdom0.048077
hmong0.038462
africa0.038462
colon0.038462
rectum0.038462
hiv infection0.038462
dog0.038462
state of tennessee0.038462
state of colorado0.038462
gay0.038462
age 5-13 years0.038462
bolivia0.038462
chuquisaca department0.038462
hunter gatherer0.038462
small village0.038462
colombia0.028846
female0.028846
rattus0.028846
rat0.028846
wistar rat0.028846
czech republic0.028846
ovis aries0.028846
age 30 days0.028846
dairy0.028846
right colon0.028846
left colon0.028846
nepal0.028846
himalayas0.028846
rectal swab0.028846
amerindian0.028846
venezuela0.028846
LOWER IN duodenum0.028846
india0.028846
LOWER IN crohn's disease0.028846
infant0.028846
age0.028846
LOWER IN female0.019231
nigeria0.019231
french republic0.019231
spondyloarthritis0.019231
spondylitis0.019231
high bmi0.019231
LOWER IN low bmi0.019231
acinonyx jubatus0.019231
tibet autonomous region0.019231
tibetan plateau0.019231
madagascar0.019231
antananarivo0.019231
denver0.019231
metabolic syndrome0.019231
kingdom of spain0.019231
LOWER IN heterosexual0.019231
LOWER IN msw0.019231
age >940.019231
duodenum0.019231
egypt0.019231
el salvador0.019231
LOWER IN child0.019231
monkey0.019231
LOWER IN age 30-500.019231
LOWER IN age 60-790.019231
peru0.019231
tunapuco0.019231
skin0.019231
kingdom of denmark0.019231
LOWER IN city0.019231
LOWER IN mouth mucosa0.019231
LOWER IN mouth0.019231
medellin metropolitan area0.009615
daycare0.009615
age 1-5 years0.009615
trichuriasis0.009615
central african republic0.009615
bangui0.009615
hmong 2nd generation0.009615
south africa0.009615
cheetah0.009615
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
358amnonhighfreq rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
256amnonhighfreq sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
312amnonhighfreq feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
563amnon high in hiv infection compared to control in homosexual msm male united states of america rectal swab feces homo sapiens 2019-11-18v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
563amnoncommon control, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 103
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
563amnoncommon hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org