Search result for sequence:
TACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGTAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATAGAAACTATCATTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
sus scrofa0.403846
pig0.403846
ireland0.307692
rumen0.303030
bos taurus0.294737
holstein-friesian bull0.272727
holstein dairy cow0.200000
state of mississippi0.200000
cow0.184615
female organism0.181818
pregnancy0.169014
ruminal fluid0.133333
farm0.113208
commonwealth of pennsylvania0.111111
duroc pig0.111111
high milk yield0.111111
LOWER IN low milk yield0.111111
age 100 days0.111111
farm 20.111111
LOWER IN farm 10.111111
jinhua city prefecture0.111111
jinhua pig0.111111
660 days0.111111
LOWER IN 605 days0.111111
early pregnancy0.111111
first pregnancy0.111111
LOWER IN multiple pregnancies0.111111
LOWER IN jersey cow0.111111
LOWER IN restricted diet0.111111
nanchang city prefecture0.105263
age 140 days0.105263
province of quebec0.105263
lamb0.100000
state of nebraska0.100000
LOWER IN left colon0.100000
rumen liquid0.095238
shandong province0.095238
state of tennessee0.095238
LOWER IN right colon0.095238
normal diet0.095238
adult organism0.090909
jejunum0.086957
belgium0.083333
male organism0.076923
sheep0.074074
ovis aries0.068966
duodenum0.068966
LOWER IN female organism0.066667
crohn's disease0.066667
zoological garden0.064516
ileum0.058824
age0.054054
united kingdom0.050000
research facility0.046332
canada0.043478
diet0.040816
child0.036364
LOWER IN caecum0.034483
feces0.033453
male0.033333
china0.029851
united states of america0.029666
LOWER IN female0.024390
female0.024390
adult0.009901
LOWER IN control0.009709
control0.009709
homo sapiens0.006557
LOWER IN feces0.005540
Fraction of dbbact annotations with this term covered by the query
TermScore
duroc pig0.500000
high milk yield0.500000
LOWER IN low milk yield0.500000
holstein dairy cow0.500000
age 100 days0.500000
farm 20.500000
LOWER IN farm 10.500000
jinhua city prefecture0.500000
jinhua pig0.500000
660 days0.500000
LOWER IN 605 days0.500000
holstein-friesian bull0.500000
early pregnancy0.500000
first pregnancy0.500000
LOWER IN multiple pregnancies0.500000
LOWER IN jersey cow0.500000
state of mississippi0.500000
LOWER IN restricted diet0.500000
ireland0.400000
sus scrofa0.375000
pig0.375000
nanchang city prefecture0.333333
age 140 days0.333333
province of quebec0.333333
lamb0.250000
state of nebraska0.250000
LOWER IN left colon0.250000
bos taurus0.222222
rumen0.217391
rumen liquid0.200000
shandong province0.200000
state of tennessee0.200000
LOWER IN right colon0.200000
normal diet0.200000
cow0.181818
pregnancy0.153846
female organism0.142857
jejunum0.142857
ruminal fluid0.142857
belgium0.125000
male organism0.100000
commonwealth of pennsylvania0.100000
sheep0.090909
farm0.081081
ovis aries0.076923
duodenum0.076923
LOWER IN female organism0.071429
crohn's disease0.071429
adult organism0.071429
zoological garden0.066667
ileum0.055556
age0.047619
united kingdom0.041667
canada0.033333
diet0.030303
child0.025641
research facility0.024691
LOWER IN caecum0.023810
male0.022727
feces0.017391
china0.016216
united states of america0.015444
LOWER IN female0.015152
female0.015152
adult0.005376
LOWER IN control0.005263
control0.005263
homo sapiens0.003460
LOWER IN feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
rumen0.500000
feces0.437500
sus scrofa0.437500
pig0.437500
bos taurus0.437500
research facility0.375000
united states of america0.375000
ireland0.250000
female organism0.250000
china0.187500
farm0.187500
holstein-friesian bull0.187500
cow0.187500
pregnancy0.187500
holstein dairy cow0.125000
commonwealth of pennsylvania0.125000
adult organism0.125000
ruminal fluid0.125000
state of mississippi0.125000
male0.062500
male organism0.062500
LOWER IN female0.062500
LOWER IN female organism0.062500
nanchang city prefecture0.062500
duroc pig0.062500
age 140 days0.062500
high milk yield0.062500
LOWER IN low milk yield0.062500
rumen liquid0.062500
shandong province0.062500
crohn's disease0.062500
LOWER IN control0.062500
homo sapiens0.062500
belgium0.062500
ovis aries0.062500
child0.062500
sheep0.062500
lamb0.062500
age 100 days0.062500
farm 20.062500
LOWER IN farm 10.062500
jinhua city prefecture0.062500
jinhua pig0.062500
age0.062500
660 days0.062500
LOWER IN 605 days0.062500
state of nebraska0.062500
early pregnancy0.062500
state of tennessee0.062500
zoological garden0.062500
first pregnancy0.062500
LOWER IN multiple pregnancies0.062500
duodenum0.062500
jejunum0.062500
ileum0.062500
LOWER IN caecum0.062500
LOWER IN left colon0.062500
LOWER IN right colon0.062500
united kingdom0.062500
female0.062500
adult0.062500
canada0.062500
province of quebec0.062500
LOWER IN jersey cow0.062500
control0.062500
diet0.062500
normal diet0.062500
LOWER IN restricted diet0.062500
LOWER IN feces0.062500
Exp. ID User ID Description Date Region Flag Sequences
688amnon high in male male organism compared to female female organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 39
687amnon high in high milk yield compared to low milk yield in research facility rumen bos taurus rumen liquid shandong province china holstein dairy cow 2028-03-09v4No1 / 40
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
491amnoncommon farm, rumen, ovis aries, child, ireland, sheep, lamb, age 100 days2019-02-26v4No1 / 105
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 248
261amnoncommon united states of america, rumen, bos taurus, state of nebraska, cow2017-12-10v4No1 / 266
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
748amnon high in holstein dairy cow compared to jersey cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 638
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
748amnon high in rumen ruminal fluid compared to feces in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2716

Problems / suggestions? Please email info AT dbbact DOT org